FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633168_at:

>probe:Drosophila_2:1633168_at:177:561; Interrogation_Position=302; Antisense; GGAAAAATCCGCCACCGAATTGCAC
>probe:Drosophila_2:1633168_at:521:247; Interrogation_Position=319; Antisense; AATTGCACCGCCGATTTGCATCACG
>probe:Drosophila_2:1633168_at:449:529; Interrogation_Position=344; Antisense; GGGATCTTCTTCACTGGACGGCAGG
>probe:Drosophila_2:1633168_at:420:503; Interrogation_Position=376; Antisense; GGGCCAGTTGGCTCCGTATACGAAG
>probe:Drosophila_2:1633168_at:608:537; Interrogation_Position=403; Antisense; GGTCACTTCCGGCTGGATATACGAT
>probe:Drosophila_2:1633168_at:2:545; Interrogation_Position=417; Antisense; GGATATACGATTTCCGGCCAGCTAT
>probe:Drosophila_2:1633168_at:207:197; Interrogation_Position=490; Antisense; AACGTGGACAGTCGCGGCGCCATTT
>probe:Drosophila_2:1633168_at:410:325; Interrogation_Position=530; Antisense; GCGAACGATGGTCCCCAGTGATGAA
>probe:Drosophila_2:1633168_at:394:369; Interrogation_Position=552; Antisense; GAATGTGGCCAAGGTTCTACTTTCC
>probe:Drosophila_2:1633168_at:147:473; Interrogation_Position=565; Antisense; GTTCTACTTTCCATTTACGTGCTGA
>probe:Drosophila_2:1633168_at:720:509; Interrogation_Position=597; Antisense; GTGCAATCCAGATGATCCGCTAGTC
>probe:Drosophila_2:1633168_at:111:47; Interrogation_Position=611; Antisense; ATCCGCTAGTCATGTGCATTGCCGA
>probe:Drosophila_2:1633168_at:545:247; Interrogation_Position=669; Antisense; AATTGCTAGACACTGGACCAAGCTG
>probe:Drosophila_2:1633168_at:212:415; Interrogation_Position=684; Antisense; GACCAAGCTGTTTGCGATGACCAAG

Paste this into a BLAST search page for me
GGAAAAATCCGCCACCGAATTGCACAATTGCACCGCCGATTTGCATCACGGGGATCTTCTTCACTGGACGGCAGGGGGCCAGTTGGCTCCGTATACGAAGGGTCACTTCCGGCTGGATATACGATGGATATACGATTTCCGGCCAGCTATAACGTGGACAGTCGCGGCGCCATTTGCGAACGATGGTCCCCAGTGATGAAGAATGTGGCCAAGGTTCTACTTTCCGTTCTACTTTCCATTTACGTGCTGAGTGCAATCCAGATGATCCGCTAGTCATCCGCTAGTCATGTGCATTGCCGAAATTGCTAGACACTGGACCAAGCTGGACCAAGCTGTTTGCGATGACCAAG

Full Affymetrix probeset data:

Annotations for 1633168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720