FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633170_at:

>probe:Drosophila_2:1633170_at:84:47; Interrogation_Position=215; Antisense; ATCCGCTGCTAATTGATCAAGTGGC
>probe:Drosophila_2:1633170_at:267:467; Interrogation_Position=354; Antisense; GTTGGCATACGCACTGAACGAGCTG
>probe:Drosophila_2:1633170_at:98:383; Interrogation_Position=369; Antisense; GAACGAGCTGCAGACCATAATGGGC
>probe:Drosophila_2:1633170_at:268:391; Interrogation_Position=417; Antisense; GAAACTACGAATCTCGCACAGGATT
>probe:Drosophila_2:1633170_at:201:709; Interrogation_Position=440; Antisense; TTAATCCGGCGCTTTTCCAGAGAAT
>probe:Drosophila_2:1633170_at:20:371; Interrogation_Position=461; Antisense; GAATGGGCACAAGACGCTTCTACAT
>probe:Drosophila_2:1633170_at:264:723; Interrogation_Position=507; Antisense; TTGGTTTGGCGCCTCAAACACCTGT
>probe:Drosophila_2:1633170_at:409:179; Interrogation_Position=522; Antisense; AAACACCTGTCGTCAATTGGGCGGT
>probe:Drosophila_2:1633170_at:411:495; Interrogation_Position=545; Antisense; GTCACATTGCCACCATCAGGGATGA
>probe:Drosophila_2:1633170_at:325:57; Interrogation_Position=581; Antisense; ATGAGATCTTCTCAAGAGCGCCGGC
>probe:Drosophila_2:1633170_at:679:305; Interrogation_Position=601; Antisense; CCGGCCGGCGTCTTTTGGATAGATA
>probe:Drosophila_2:1633170_at:525:209; Interrogation_Position=640; Antisense; AAGAACGGCCTTTTTGCATCATCAC
>probe:Drosophila_2:1633170_at:541:43; Interrogation_Position=675; Antisense; ATCGCCGCCGTTCTTTAAGTGGAAG
>probe:Drosophila_2:1633170_at:287:603; Interrogation_Position=782; Antisense; TGTTCATATGTCAAGCCGAGCAGTG

Paste this into a BLAST search page for me
ATCCGCTGCTAATTGATCAAGTGGCGTTGGCATACGCACTGAACGAGCTGGAACGAGCTGCAGACCATAATGGGCGAAACTACGAATCTCGCACAGGATTTTAATCCGGCGCTTTTCCAGAGAATGAATGGGCACAAGACGCTTCTACATTTGGTTTGGCGCCTCAAACACCTGTAAACACCTGTCGTCAATTGGGCGGTGTCACATTGCCACCATCAGGGATGAATGAGATCTTCTCAAGAGCGCCGGCCCGGCCGGCGTCTTTTGGATAGATAAAGAACGGCCTTTTTGCATCATCACATCGCCGCCGTTCTTTAAGTGGAAGTGTTCATATGTCAAGCCGAGCAGTG

Full Affymetrix probeset data:

Annotations for 1633170_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720