FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633171_at:

>probe:Drosophila_2:1633171_at:537:343; Interrogation_Position=1013; Antisense; GCTTCTTTAAGCAACGCCATCTGGA
>probe:Drosophila_2:1633171_at:136:221; Interrogation_Position=478; Antisense; AAGTGCTCCCTGAACGAAGTTTCCA
>probe:Drosophila_2:1633171_at:349:189; Interrogation_Position=527; Antisense; AACAGGCGATCGATGCGGGCGTCAA
>probe:Drosophila_2:1633171_at:615:421; Interrogation_Position=601; Antisense; GAGAAGTTGCTCAAACGTTTCCCCA
>probe:Drosophila_2:1633171_at:157:695; Interrogation_Position=618; Antisense; TTTCCCCAGCTTTAAAATCACCGTG
>probe:Drosophila_2:1633171_at:18:577; Interrogation_Position=642; Antisense; GGCGAAAAAAGCTGACTCCACCTAT
>probe:Drosophila_2:1633171_at:367:89; Interrogation_Position=672; Antisense; AGTCTCTGCTGCTAGTATATGCGCC
>probe:Drosophila_2:1633171_at:491:683; Interrogation_Position=689; Antisense; TATGCGCCAAAGTTACCCGTGATCA
>probe:Drosophila_2:1633171_at:646:453; Interrogation_Position=709; Antisense; GATCATGCCCTCAAGGTGTGGAGCT
>probe:Drosophila_2:1633171_at:613:707; Interrogation_Position=733; Antisense; TTCCCCGAGGGCTTGGTCATTAAGG
>probe:Drosophila_2:1633171_at:423:479; Interrogation_Position=831; Antisense; GTTTGGATTTCCACGACTTGTGCGC
>probe:Drosophila_2:1633171_at:658:121; Interrogation_Position=917; Antisense; AGCCGGATTCCGAGAAGCCCAAGTA
>probe:Drosophila_2:1633171_at:297:565; Interrogation_Position=946; Antisense; GGCACCAAGCTCACAAAGTTCTTTA
>probe:Drosophila_2:1633171_at:205:33; Interrogation_Position=994; Antisense; ATAATTCGCGAGGAGTGCCGCTTCT

Paste this into a BLAST search page for me
GCTTCTTTAAGCAACGCCATCTGGAAAGTGCTCCCTGAACGAAGTTTCCAAACAGGCGATCGATGCGGGCGTCAAGAGAAGTTGCTCAAACGTTTCCCCATTTCCCCAGCTTTAAAATCACCGTGGGCGAAAAAAGCTGACTCCACCTATAGTCTCTGCTGCTAGTATATGCGCCTATGCGCCAAAGTTACCCGTGATCAGATCATGCCCTCAAGGTGTGGAGCTTTCCCCGAGGGCTTGGTCATTAAGGGTTTGGATTTCCACGACTTGTGCGCAGCCGGATTCCGAGAAGCCCAAGTAGGCACCAAGCTCACAAAGTTCTTTAATAATTCGCGAGGAGTGCCGCTTCT

Full Affymetrix probeset data:

Annotations for 1633171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720