Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633173_s_at:

>probe:Drosophila_2:1633173_s_at:33:215; Interrogation_Position=113; Antisense; AAGAGGAGATGGACGCGCAACTGCA
>probe:Drosophila_2:1633173_s_at:632:63; Interrogation_Position=13; Antisense; ATGGGTACGGGCTACCAGCGGCTGG
>probe:Drosophila_2:1633173_s_at:403:121; Interrogation_Position=144; Antisense; AGCGGTGGCTGTGCCTGTCGGCGAT
>probe:Drosophila_2:1633173_s_at:181:57; Interrogation_Position=167; Antisense; ATGAGGCTGGGAACCAGGGAACCAT
>probe:Drosophila_2:1633173_s_at:608:377; Interrogation_Position=177; Antisense; GAACCAGGGAACCATCGCCACTTGG
>probe:Drosophila_2:1633173_s_at:652:525; Interrogation_Position=183; Antisense; GGGAACCATCGCCACTTGGCTCTGG
>probe:Drosophila_2:1633173_s_at:680:43; Interrogation_Position=190; Antisense; ATCGCCACTTGGCTCTGGCTGTGGC
>probe:Drosophila_2:1633173_s_at:723:285; Interrogation_Position=214; Antisense; CTGTGGCTGCTAGTGTTGCTGGTGC
>probe:Drosophila_2:1633173_s_at:412:339; Interrogation_Position=23; Antisense; GCTACCAGCGGCTGGTGCGCCTGCT
>probe:Drosophila_2:1633173_s_at:29:621; Interrogation_Position=239; Antisense; TGCTGTTGGTCCTGGGCCTGCCGCT
>probe:Drosophila_2:1633173_s_at:306:595; Interrogation_Position=251; Antisense; TGGGCCTGCCGCTGCTTTTGATGAT
>probe:Drosophila_2:1633173_s_at:293:631; Interrogation_Position=50; Antisense; TCCTGCTGCAGCGTCGTCGCTTTGG
>probe:Drosophila_2:1633173_s_at:65:293; Interrogation_Position=61; Antisense; CGTCGTCGCTTTGGCGGCCGCAAGA
>probe:Drosophila_2:1633173_s_at:522:139; Interrogation_Position=91; Antisense; ACGGCGGCGGCGAACGAAGTGGAAG

Paste this into a BLAST search page for me
AAGAGGAGATGGACGCGCAACTGCAATGGGTACGGGCTACCAGCGGCTGGAGCGGTGGCTGTGCCTGTCGGCGATATGAGGCTGGGAACCAGGGAACCATGAACCAGGGAACCATCGCCACTTGGGGGAACCATCGCCACTTGGCTCTGGATCGCCACTTGGCTCTGGCTGTGGCCTGTGGCTGCTAGTGTTGCTGGTGCGCTACCAGCGGCTGGTGCGCCTGCTTGCTGTTGGTCCTGGGCCTGCCGCTTGGGCCTGCCGCTGCTTTTGATGATTCCTGCTGCAGCGTCGTCGCTTTGGCGTCGTCGCTTTGGCGGCCGCAAGAACGGCGGCGGCGAACGAAGTGGAAG

Full Affymetrix probeset data:

Annotations for 1633173_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime