Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633174_at:

>probe:Drosophila_2:1633174_at:452:131; Interrogation_Position=2467; Antisense; ACCCGACACTCGCATTCATGCAAAA
>probe:Drosophila_2:1633174_at:322:645; Interrogation_Position=2501; Antisense; TCATTTGGAATTTAACGCTTTTGTT
>probe:Drosophila_2:1633174_at:488:689; Interrogation_Position=2530; Antisense; TATTATTGTTTTTATGGTTTCGGCT
>probe:Drosophila_2:1633174_at:724:61; Interrogation_Position=2543; Antisense; ATGGTTTCGGCTTTAGTTCAATTAT
>probe:Drosophila_2:1633174_at:129:475; Interrogation_Position=2558; Antisense; GTTCAATTATTTAAGCACTCTAGTT
>probe:Drosophila_2:1633174_at:690:207; Interrogation_Position=2570; Antisense; AAGCACTCTAGTTCAAATTTTAAAG
>probe:Drosophila_2:1633174_at:291:175; Interrogation_Position=2639; Antisense; AAACGTGAGGAACCATGTCATTTAA
>probe:Drosophila_2:1633174_at:483:655; Interrogation_Position=2667; Antisense; TAAGAGGCCGATCCCGAAATCAGAC
>probe:Drosophila_2:1633174_at:531:239; Interrogation_Position=2684; Antisense; AATCAGACCCCTTAATCATTTGTAG
>probe:Drosophila_2:1633174_at:325:187; Interrogation_Position=2777; Antisense; AACACGCTCATTAATTTCATCCATA
>probe:Drosophila_2:1633174_at:477:215; Interrogation_Position=2838; Antisense; AAGTTGTAAACTTCTGCTAGGTACA
>probe:Drosophila_2:1633174_at:281:341; Interrogation_Position=2853; Antisense; GCTAGGTACAATTTACGCTTATTAT
>probe:Drosophila_2:1633174_at:289:61; Interrogation_Position=2890; Antisense; ATGTAATCCGTAACCGAACAACAAG
>probe:Drosophila_2:1633174_at:14:385; Interrogation_Position=2905; Antisense; GAACAACAAGGCACCGAAACGCAAA

Paste this into a BLAST search page for me
ACCCGACACTCGCATTCATGCAAAATCATTTGGAATTTAACGCTTTTGTTTATTATTGTTTTTATGGTTTCGGCTATGGTTTCGGCTTTAGTTCAATTATGTTCAATTATTTAAGCACTCTAGTTAAGCACTCTAGTTCAAATTTTAAAGAAACGTGAGGAACCATGTCATTTAATAAGAGGCCGATCCCGAAATCAGACAATCAGACCCCTTAATCATTTGTAGAACACGCTCATTAATTTCATCCATAAAGTTGTAAACTTCTGCTAGGTACAGCTAGGTACAATTTACGCTTATTATATGTAATCCGTAACCGAACAACAAGGAACAACAAGGCACCGAAACGCAAA

Full Affymetrix probeset data:

Annotations for 1633174_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime