FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633176_at:

>probe:Drosophila_2:1633176_at:329:407; Interrogation_Position=111; Antisense; GACTGGCAGTGGTCACCAGTTGCTG
>probe:Drosophila_2:1633176_at:613:355; Interrogation_Position=166; Antisense; GCACTGTCCGATGCCATGGATGTGG
>probe:Drosophila_2:1633176_at:49:707; Interrogation_Position=17; Antisense; TTAGCCAGCACAACGGTGCAGCAGT
>probe:Drosophila_2:1633176_at:212:591; Interrogation_Position=188; Antisense; TGGTGTGTCCCCATGGCTTTAATAC
>probe:Drosophila_2:1633176_at:478:341; Interrogation_Position=203; Antisense; GCTTTAATACGCTGCCAAGGAAACG
>probe:Drosophila_2:1633176_at:543:177; Interrogation_Position=223; Antisense; AAACGTGAAAGCTTGCTGGGCAACA
>probe:Drosophila_2:1633176_at:48:545; Interrogation_Position=319; Antisense; GGATACTCTTTTAGTCCACTGCTAA
>probe:Drosophila_2:1633176_at:134:281; Interrogation_Position=337; Antisense; CTGCTAACCAATCTGTACGGATCCG
>probe:Drosophila_2:1633176_at:44:489; Interrogation_Position=351; Antisense; GTACGGATCCGAGGTCCTGATCAAG
>probe:Drosophila_2:1633176_at:113:99; Interrogation_Position=374; Antisense; AGATGCGTCGCCACAGGAGACACCT
>probe:Drosophila_2:1633176_at:342:409; Interrogation_Position=415; Antisense; GACGAGTGCTGCGTCAAGACCTGCA
>probe:Drosophila_2:1633176_at:374:213; Interrogation_Position=430; Antisense; AAGACCTGCAGCTACTTGGAGTTAG
>probe:Drosophila_2:1633176_at:493:705; Interrogation_Position=451; Antisense; TTAGCCATCTACTGTCTACCGAAAT
>probe:Drosophila_2:1633176_at:305:227; Interrogation_Position=93; Antisense; AATGGCAATGGTCACGCCGACTGGC

Paste this into a BLAST search page for me
GACTGGCAGTGGTCACCAGTTGCTGGCACTGTCCGATGCCATGGATGTGGTTAGCCAGCACAACGGTGCAGCAGTTGGTGTGTCCCCATGGCTTTAATACGCTTTAATACGCTGCCAAGGAAACGAAACGTGAAAGCTTGCTGGGCAACAGGATACTCTTTTAGTCCACTGCTAACTGCTAACCAATCTGTACGGATCCGGTACGGATCCGAGGTCCTGATCAAGAGATGCGTCGCCACAGGAGACACCTGACGAGTGCTGCGTCAAGACCTGCAAAGACCTGCAGCTACTTGGAGTTAGTTAGCCATCTACTGTCTACCGAAATAATGGCAATGGTCACGCCGACTGGC

Full Affymetrix probeset data:

Annotations for 1633176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720