FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633178_at:

>probe:Drosophila_2:1633178_at:683:359; Interrogation_Position=1961; Antisense; GCAAGCGACACGGACATTTCTGATG
>probe:Drosophila_2:1633178_at:541:363; Interrogation_Position=1994; Antisense; GAATCTAAGTCTCCCATCGAAATCC
>probe:Drosophila_2:1633178_at:458:59; Interrogation_Position=2101; Antisense; ATGTTGCAGAGTTGGCCACGTTTTC
>probe:Drosophila_2:1633178_at:1:673; Interrogation_Position=2219; Antisense; TACCATAAATGTTCCGTACGCCTGC
>probe:Drosophila_2:1633178_at:216:165; Interrogation_Position=2256; Antisense; AAATCCACAATCCTTAGCGAGGTAG
>probe:Drosophila_2:1633178_at:657:73; Interrogation_Position=2275; Antisense; AGGTAGGGTGCTCTCTTTCCTTCAA
>probe:Drosophila_2:1633178_at:406:695; Interrogation_Position=2290; Antisense; TTTCCTTCAACTGCAGGCTGGGATC
>probe:Drosophila_2:1633178_at:50:49; Interrogation_Position=2329; Antisense; ATCCAGCTGCTGTCATGTCGTAGTA
>probe:Drosophila_2:1633178_at:334:647; Interrogation_Position=2341; Antisense; TCATGTCGTAGTAGTGCATTCCCAC
>probe:Drosophila_2:1633178_at:60:345; Interrogation_Position=2356; Antisense; GCATTCCCACCCAGAAGTCATAGAG
>probe:Drosophila_2:1633178_at:257:101; Interrogation_Position=2377; Antisense; AGAGTCCATTGGCATTTACCTCCAA
>probe:Drosophila_2:1633178_at:528:31; Interrogation_Position=2403; Antisense; ATAAGTTGGCTGACGGGCTCTGTGA
>probe:Drosophila_2:1633178_at:530:159; Interrogation_Position=2428; Antisense; ACAAGGAATTCTGCGGCCATTGGAA
>probe:Drosophila_2:1633178_at:309:415; Interrogation_Position=2469; Antisense; GACCACAGGCAGTCATCCGTGGAGT

Paste this into a BLAST search page for me
GCAAGCGACACGGACATTTCTGATGGAATCTAAGTCTCCCATCGAAATCCATGTTGCAGAGTTGGCCACGTTTTCTACCATAAATGTTCCGTACGCCTGCAAATCCACAATCCTTAGCGAGGTAGAGGTAGGGTGCTCTCTTTCCTTCAATTTCCTTCAACTGCAGGCTGGGATCATCCAGCTGCTGTCATGTCGTAGTATCATGTCGTAGTAGTGCATTCCCACGCATTCCCACCCAGAAGTCATAGAGAGAGTCCATTGGCATTTACCTCCAAATAAGTTGGCTGACGGGCTCTGTGAACAAGGAATTCTGCGGCCATTGGAAGACCACAGGCAGTCATCCGTGGAGT

Full Affymetrix probeset data:

Annotations for 1633178_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720