FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633179_at:

>probe:Drosophila_2:1633179_at:68:485; Interrogation_Position=1045; Antisense; GTATCCTATAACTACGACACCCAAT
>probe:Drosophila_2:1633179_at:652:517; Interrogation_Position=1084; Antisense; GTGGGCCGCCTAATGGCAAACATTC
>probe:Drosophila_2:1633179_at:90:105; Interrogation_Position=1122; Antisense; AGACTCCTCGGGACAGTTGCAAGGT
>probe:Drosophila_2:1633179_at:274:425; Interrogation_Position=1162; Antisense; GAGATCCTCTGTCACAATGGGCAAC
>probe:Drosophila_2:1633179_at:150:251; Interrogation_Position=1176; Antisense; CAATGGGCAACCCTGGAGCGGTTAT
>probe:Drosophila_2:1633179_at:677:579; Interrogation_Position=1215; Antisense; GGCCACCGCCGAGATGAGAGATTCA
>probe:Drosophila_2:1633179_at:667:57; Interrogation_Position=1277; Antisense; ATGAGGATCACTACCTGCACATCGT
>probe:Drosophila_2:1633179_at:61:485; Interrogation_Position=1341; Antisense; GTACTATCCCCACGAGGTCGAGGAA
>probe:Drosophila_2:1633179_at:682:373; Interrogation_Position=1363; Antisense; GAAGTAATCGCCCAGATGCCAGACG
>probe:Drosophila_2:1633179_at:608:595; Interrogation_Position=1449; Antisense; TGTGGTCCTGCGATCCGGTAGCAAA
>probe:Drosophila_2:1633179_at:712:177; Interrogation_Position=1471; Antisense; AAACTGGATCCCAAGCACGTGGAGC
>probe:Drosophila_2:1633179_at:714:89; Interrogation_Position=1523; Antisense; AGTTTAAACATCTCCATGGCGGCGT
>probe:Drosophila_2:1633179_at:1:713; Interrogation_Position=1547; Antisense; TTCAGTTCGTTCCACAGCTGGCGAA
>probe:Drosophila_2:1633179_at:442:555; Interrogation_Position=1611; Antisense; GGCCTACTTGAGAGATGCTACCCAG

Paste this into a BLAST search page for me
GTATCCTATAACTACGACACCCAATGTGGGCCGCCTAATGGCAAACATTCAGACTCCTCGGGACAGTTGCAAGGTGAGATCCTCTGTCACAATGGGCAACCAATGGGCAACCCTGGAGCGGTTATGGCCACCGCCGAGATGAGAGATTCAATGAGGATCACTACCTGCACATCGTGTACTATCCCCACGAGGTCGAGGAAGAAGTAATCGCCCAGATGCCAGACGTGTGGTCCTGCGATCCGGTAGCAAAAAACTGGATCCCAAGCACGTGGAGCAGTTTAAACATCTCCATGGCGGCGTTTCAGTTCGTTCCACAGCTGGCGAAGGCCTACTTGAGAGATGCTACCCAG

Full Affymetrix probeset data:

Annotations for 1633179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720