FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633180_at:

>probe:Drosophila_2:1633180_at:391:549; Interrogation_Position=1981; Antisense; GGAGGATGCTGAGCCCACTGTAAAC
>probe:Drosophila_2:1633180_at:411:423; Interrogation_Position=2010; Antisense; GAGACTATATATCCACACTTTAAAG
>probe:Drosophila_2:1633180_at:274:383; Interrogation_Position=2094; Antisense; GAACTCGCTGCGTTTAGGCATAGTT
>probe:Drosophila_2:1633180_at:1:679; Interrogation_Position=2108; Antisense; TAGGCATAGTTTTCCCGGCGAACCG
>probe:Drosophila_2:1633180_at:464:151; Interrogation_Position=2137; Antisense; ACATCGCCGCACTCAAATGGGAGAT
>probe:Drosophila_2:1633180_at:158:25; Interrogation_Position=2169; Antisense; ATATGATCCAAAACGAAACGCCTCG
>probe:Drosophila_2:1633180_at:139:157; Interrogation_Position=2184; Antisense; AAACGCCTCGATGAAAATTTTCCAT
>probe:Drosophila_2:1633180_at:225:17; Interrogation_Position=2200; Antisense; ATTTTCCATTGGACGGGCCTGTCGA
>probe:Drosophila_2:1633180_at:328:597; Interrogation_Position=2219; Antisense; TGTCGACGCACACTATCAAAACTCT
>probe:Drosophila_2:1633180_at:552:363; Interrogation_Position=2246; Antisense; GAATAAAACCCAAGATCCAGGCCTG
>probe:Drosophila_2:1633180_at:203:447; Interrogation_Position=2259; Antisense; GATCCAGGCCTGGTCCAATGTAGAA
>probe:Drosophila_2:1633180_at:397:239; Interrogation_Position=2334; Antisense; AATACAGTTAACCTTACGCACGCAC
>probe:Drosophila_2:1633180_at:35:245; Interrogation_Position=2384; Antisense; AATTCGCACACTTAATCTAACCCAA
>probe:Drosophila_2:1633180_at:269:493; Interrogation_Position=2480; Antisense; GTAATATCTGCAAAGGGCGCGAATA

Paste this into a BLAST search page for me
GGAGGATGCTGAGCCCACTGTAAACGAGACTATATATCCACACTTTAAAGGAACTCGCTGCGTTTAGGCATAGTTTAGGCATAGTTTTCCCGGCGAACCGACATCGCCGCACTCAAATGGGAGATATATGATCCAAAACGAAACGCCTCGAAACGCCTCGATGAAAATTTTCCATATTTTCCATTGGACGGGCCTGTCGATGTCGACGCACACTATCAAAACTCTGAATAAAACCCAAGATCCAGGCCTGGATCCAGGCCTGGTCCAATGTAGAAAATACAGTTAACCTTACGCACGCACAATTCGCACACTTAATCTAACCCAAGTAATATCTGCAAAGGGCGCGAATA

Full Affymetrix probeset data:

Annotations for 1633180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720