FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633181_at:

>probe:Drosophila_2:1633181_at:669:75; Interrogation_Position=4742; Antisense; AGGTACAGGCGCTTCAACCGGTGGC
>probe:Drosophila_2:1633181_at:162:39; Interrogation_Position=4802; Antisense; ATCTGCTGCCGGTGGACAAGGGTTT
>probe:Drosophila_2:1633181_at:74:137; Interrogation_Position=4829; Antisense; ACGAAGCTGGGATGGATCTCCGCCA
>probe:Drosophila_2:1633181_at:364:205; Interrogation_Position=4865; Antisense; AAGCCGAGGCCTTCGTTATGCTCAA
>probe:Drosophila_2:1633181_at:427:683; Interrogation_Position=4881; Antisense; TATGCTCAACCACTATCTGGACGTG
>probe:Drosophila_2:1633181_at:254:383; Interrogation_Position=5010; Antisense; GAACGATCCCAGTCTTCACGAGGAG
>probe:Drosophila_2:1633181_at:53:511; Interrogation_Position=5039; Antisense; GTGAATGGGTTCTCGCCGTGAGCAT
>probe:Drosophila_2:1633181_at:237:59; Interrogation_Position=5096; Antisense; ATGATCGCGGCTTGTACGAGTCCAG
>probe:Drosophila_2:1633181_at:238:285; Interrogation_Position=5142; Antisense; CTGCATGCTGAGTGGATTCCCGGTA
>probe:Drosophila_2:1633181_at:380:493; Interrogation_Position=5174; Antisense; GTCAACCGGTGACCTTTCAAGGATC
>probe:Drosophila_2:1633181_at:254:133; Interrogation_Position=5213; Antisense; ACCGCGACGTGTGGAGCAAGTTCTC
>probe:Drosophila_2:1633181_at:463:471; Interrogation_Position=5232; Antisense; GTTCTCGGTCGCCTTGAAGATGTCA
>probe:Drosophila_2:1633181_at:110:565; Interrogation_Position=5266; Antisense; GGAATTGCCGACATCATTTCGTTCA
>probe:Drosophila_2:1633181_at:366:553; Interrogation_Position=5305; Antisense; GGAGCAGCCAACTACGTGATGCATT

Paste this into a BLAST search page for me
AGGTACAGGCGCTTCAACCGGTGGCATCTGCTGCCGGTGGACAAGGGTTTACGAAGCTGGGATGGATCTCCGCCAAAGCCGAGGCCTTCGTTATGCTCAATATGCTCAACCACTATCTGGACGTGGAACGATCCCAGTCTTCACGAGGAGGTGAATGGGTTCTCGCCGTGAGCATATGATCGCGGCTTGTACGAGTCCAGCTGCATGCTGAGTGGATTCCCGGTAGTCAACCGGTGACCTTTCAAGGATCACCGCGACGTGTGGAGCAAGTTCTCGTTCTCGGTCGCCTTGAAGATGTCAGGAATTGCCGACATCATTTCGTTCAGGAGCAGCCAACTACGTGATGCATT

Full Affymetrix probeset data:

Annotations for 1633181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720