FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633182_at:

>probe:Drosophila_2:1633182_at:464:5; Interrogation_Position=1009; Antisense; ATTGCTGGCAAGGAGTTCTTCGTGA
>probe:Drosophila_2:1633182_at:97:489; Interrogation_Position=1056; Antisense; GTACGATAATTTTTGCTTCTCCGCC
>probe:Drosophila_2:1633182_at:442:713; Interrogation_Position=1072; Antisense; TTCTCCGCCTTTATGGACATGCTAG
>probe:Drosophila_2:1633182_at:261:401; Interrogation_Position=1087; Antisense; GACATGCTAGGCCTGCAGTACTGGA
>probe:Drosophila_2:1633182_at:50:143; Interrogation_Position=1106; Antisense; ACTGGATACTCGGTGATGCCTTCAT
>probe:Drosophila_2:1633182_at:98:111; Interrogation_Position=1168; Antisense; AGAATGGGCATAGCACCGGCTGTAT
>probe:Drosophila_2:1633182_at:700:111; Interrogation_Position=596; Antisense; AGCAACTCTCTATGACCAAATCGGT
>probe:Drosophila_2:1633182_at:530:503; Interrogation_Position=619; Antisense; GTCCCTTCTTTCCAGCAAATGATTG
>probe:Drosophila_2:1633182_at:521:383; Interrogation_Position=729; Antisense; GAACTCGAGTCTGTACTACGGTCCG
>probe:Drosophila_2:1633182_at:160:579; Interrogation_Position=777; Antisense; GGCCAAGTACTGGAGCTTCAAGCTG
>probe:Drosophila_2:1633182_at:467:1; Interrogation_Position=808; Antisense; ATAGCGGTCCATGGCAAGGGTTCCA
>probe:Drosophila_2:1633182_at:308:449; Interrogation_Position=882; Antisense; GATCGTTGGTCCTGTCCTGGAAGTC
>probe:Drosophila_2:1633182_at:366:489; Interrogation_Position=957; Antisense; GTACACCGTCGCCTGTGAATCGATT
>probe:Drosophila_2:1633182_at:546:35; Interrogation_Position=994; Antisense; ATCATCGTCTTTGGCATTGCTGGCA

Paste this into a BLAST search page for me
ATTGCTGGCAAGGAGTTCTTCGTGAGTACGATAATTTTTGCTTCTCCGCCTTCTCCGCCTTTATGGACATGCTAGGACATGCTAGGCCTGCAGTACTGGAACTGGATACTCGGTGATGCCTTCATAGAATGGGCATAGCACCGGCTGTATAGCAACTCTCTATGACCAAATCGGTGTCCCTTCTTTCCAGCAAATGATTGGAACTCGAGTCTGTACTACGGTCCGGGCCAAGTACTGGAGCTTCAAGCTGATAGCGGTCCATGGCAAGGGTTCCAGATCGTTGGTCCTGTCCTGGAAGTCGTACACCGTCGCCTGTGAATCGATTATCATCGTCTTTGGCATTGCTGGCA

Full Affymetrix probeset data:

Annotations for 1633182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720