FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633184_at:

>probe:Drosophila_2:1633184_at:135:153; Interrogation_Position=1465; Antisense; ACAGGAGTACAGCTCGGGCAGCAAT
>probe:Drosophila_2:1633184_at:389:605; Interrogation_Position=1489; Antisense; TGAGGCGCGTAACCAAGTGGCCACT
>probe:Drosophila_2:1633184_at:346:581; Interrogation_Position=1506; Antisense; TGGCCACTGAAAATTCCCAGCGACT
>probe:Drosophila_2:1633184_at:497:51; Interrogation_Position=1545; Antisense; ATGCGATGCGCTCTATTGGATCCTC
>probe:Drosophila_2:1633184_at:40:573; Interrogation_Position=1603; Antisense; GGCGGATGCCTTCTACAACTTTGGG
>probe:Drosophila_2:1633184_at:530:191; Interrogation_Position=1619; Antisense; AACTTTGGGCTGCACGTTTGGGATA
>probe:Drosophila_2:1633184_at:221:263; Interrogation_Position=1647; Antisense; CAGCAGGCGCTTTGATAGTCACGGA
>probe:Drosophila_2:1633184_at:729:635; Interrogation_Position=1761; Antisense; TCGAATTGGGTAACTGCCTGCAGCA
>probe:Drosophila_2:1633184_at:581:113; Interrogation_Position=1782; Antisense; AGCAGAATTATCCATCTCCACGTGA
>probe:Drosophila_2:1633184_at:164:1; Interrogation_Position=1823; Antisense; GTTAACCCCAATGAGTACGGGCCTG
>probe:Drosophila_2:1633184_at:295:425; Interrogation_Position=1853; Antisense; GAGACCAGGGACTTTACCAGCCAAA
>probe:Drosophila_2:1633184_at:425:11; Interrogation_Position=1890; Antisense; ATTCGGATACCCCAGAAACCACTGA
>probe:Drosophila_2:1633184_at:652:323; Interrogation_Position=1940; Antisense; GCGACGCCAGCTAACTAATTGACCA
>probe:Drosophila_2:1633184_at:636:5; Interrogation_Position=1957; Antisense; ATTGACCACCAGAAAGGCCAGCTTT

Paste this into a BLAST search page for me
ACAGGAGTACAGCTCGGGCAGCAATTGAGGCGCGTAACCAAGTGGCCACTTGGCCACTGAAAATTCCCAGCGACTATGCGATGCGCTCTATTGGATCCTCGGCGGATGCCTTCTACAACTTTGGGAACTTTGGGCTGCACGTTTGGGATACAGCAGGCGCTTTGATAGTCACGGATCGAATTGGGTAACTGCCTGCAGCAAGCAGAATTATCCATCTCCACGTGAGTTAACCCCAATGAGTACGGGCCTGGAGACCAGGGACTTTACCAGCCAAAATTCGGATACCCCAGAAACCACTGAGCGACGCCAGCTAACTAATTGACCAATTGACCACCAGAAAGGCCAGCTTT

Full Affymetrix probeset data:

Annotations for 1633184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720