Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633185_at:

>probe:Drosophila_2:1633185_at:15:351; Interrogation_Position=1064; Antisense; GCAGTGCGTCATTTCGAAGATTCCG
>probe:Drosophila_2:1633185_at:370:317; Interrogation_Position=1126; Antisense; GCCTGCTCAACTACGATACTAGTCG
>probe:Drosophila_2:1633185_at:221:279; Interrogation_Position=1144; Antisense; CTAGTCGCGGAGGAATCAGTGTCAA
>probe:Drosophila_2:1633185_at:325:253; Interrogation_Position=1166; Antisense; CAAGACGGACATGCTGCCAGGACGA
>probe:Drosophila_2:1633185_at:120:557; Interrogation_Position=1185; Antisense; GGACGAGCTCTGAGTCGCCTGTATA
>probe:Drosophila_2:1633185_at:622:601; Interrogation_Position=1204; Antisense; TGTATATCGCCAATGCCAATCGCCA
>probe:Drosophila_2:1633185_at:298:193; Interrogation_Position=1239; Antisense; AACTACACCTGCATGCTGGGCAATG
>probe:Drosophila_2:1633185_at:314:253; Interrogation_Position=1349; Antisense; CAACGCCTCCACAATGGTTGTGTTA
>probe:Drosophila_2:1633185_at:170:19; Interrogation_Position=1373; Antisense; ATTTCTAGTGTACGTTTGCATCTCC
>probe:Drosophila_2:1633185_at:63:619; Interrogation_Position=1389; Antisense; TGCATCTCCGGTTCGATTTCCGTAG
>probe:Drosophila_2:1633185_at:704:211; Interrogation_Position=1469; Antisense; AAGACGATGACGACGCAGCCTAATC
>probe:Drosophila_2:1633185_at:512:451; Interrogation_Position=1498; Antisense; GATCGTAGATCCTAGATTGTGTCGC
>probe:Drosophila_2:1633185_at:201:213; Interrogation_Position=1541; Antisense; AAGAGTCTTGTCCAGGATTGCATTT
>probe:Drosophila_2:1633185_at:383:465; Interrogation_Position=1556; Antisense; GATTGCATTTTCGACTTTTACTCTA

Paste this into a BLAST search page for me
GCAGTGCGTCATTTCGAAGATTCCGGCCTGCTCAACTACGATACTAGTCGCTAGTCGCGGAGGAATCAGTGTCAACAAGACGGACATGCTGCCAGGACGAGGACGAGCTCTGAGTCGCCTGTATATGTATATCGCCAATGCCAATCGCCAAACTACACCTGCATGCTGGGCAATGCAACGCCTCCACAATGGTTGTGTTAATTTCTAGTGTACGTTTGCATCTCCTGCATCTCCGGTTCGATTTCCGTAGAAGACGATGACGACGCAGCCTAATCGATCGTAGATCCTAGATTGTGTCGCAAGAGTCTTGTCCAGGATTGCATTTGATTGCATTTTCGACTTTTACTCTA

Full Affymetrix probeset data:

Annotations for 1633185_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime