Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633187_at:

>probe:Drosophila_2:1633187_at:336:265; Interrogation_Position=2595; Antisense; CAGATACTCCACTTACGGCGATGTG
>probe:Drosophila_2:1633187_at:476:261; Interrogation_Position=2640; Antisense; CACCGAGTTTGTGGGCGAGCTGACC
>probe:Drosophila_2:1633187_at:453:161; Interrogation_Position=2680; Antisense; ACAATTACGGCCAAGTCCACGGAGG
>probe:Drosophila_2:1633187_at:69:623; Interrogation_Position=2719; Antisense; TGCGATTGCTTGACGCCTCAGCAAC
>probe:Drosophila_2:1633187_at:302:63; Interrogation_Position=2744; Antisense; AGGCTGCCATTAAGGCGGCCCAGTA
>probe:Drosophila_2:1633187_at:184:577; Interrogation_Position=2760; Antisense; GGCCCAGTACCAACTCAGTCAAAAT
>probe:Drosophila_2:1633187_at:389:185; Interrogation_Position=2780; Antisense; AAAATCAGAAGCTGTCCCACCAGAA
>probe:Drosophila_2:1633187_at:608:279; Interrogation_Position=2808; Antisense; CTGCCAGTTGGGATACTACTCGCAT
>probe:Drosophila_2:1633187_at:34:627; Interrogation_Position=2834; Antisense; TGCCGCGACCTACCACTGATGTGGG
>probe:Drosophila_2:1633187_at:602:257; Interrogation_Position=2868; Antisense; CACTAGTCAGCAGGTGCATGGTGCA
>probe:Drosophila_2:1633187_at:690:509; Interrogation_Position=2888; Antisense; GTGCAGGAGATGTCCAGACGACTTC
>probe:Drosophila_2:1633187_at:488:103; Interrogation_Position=2903; Antisense; AGACGACTTCGGAGGCCACCAGATT
>probe:Drosophila_2:1633187_at:175:495; Interrogation_Position=2932; Antisense; GTCAAAGTTGTCTAGACCGTAACGA
>probe:Drosophila_2:1633187_at:486:411; Interrogation_Position=2946; Antisense; GACCGTAACGAGATCCGTCTCAAGA

Paste this into a BLAST search page for me
CAGATACTCCACTTACGGCGATGTGCACCGAGTTTGTGGGCGAGCTGACCACAATTACGGCCAAGTCCACGGAGGTGCGATTGCTTGACGCCTCAGCAACAGGCTGCCATTAAGGCGGCCCAGTAGGCCCAGTACCAACTCAGTCAAAATAAAATCAGAAGCTGTCCCACCAGAACTGCCAGTTGGGATACTACTCGCATTGCCGCGACCTACCACTGATGTGGGCACTAGTCAGCAGGTGCATGGTGCAGTGCAGGAGATGTCCAGACGACTTCAGACGACTTCGGAGGCCACCAGATTGTCAAAGTTGTCTAGACCGTAACGAGACCGTAACGAGATCCGTCTCAAGA

Full Affymetrix probeset data:

Annotations for 1633187_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime