FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633189_at:

>probe:Drosophila_2:1633189_at:71:85; Interrogation_Position=1003; Antisense; AGTGTGCCCTTCTATGTGATGCTCA
>probe:Drosophila_2:1633189_at:517:675; Interrogation_Position=1068; Antisense; TAGCTCCGCGATGTTCATGCAGATC
>probe:Drosophila_2:1633189_at:412:421; Interrogation_Position=1093; Antisense; GAGAACTACTTCAAACTACCGGAAT
>probe:Drosophila_2:1633189_at:548:713; Interrogation_Position=1149; Antisense; TTCAGTGCTGGCCTTGGAGGTCCTA
>probe:Drosophila_2:1633189_at:436:305; Interrogation_Position=1170; Antisense; CCTAGTGGCGGAGTTTGTGCCCAGT
>probe:Drosophila_2:1633189_at:90:625; Interrogation_Position=1187; Antisense; TGCCCAGTTTTGATGCCCTGATGGA
>probe:Drosophila_2:1633189_at:276:229; Interrogation_Position=1284; Antisense; AATGGAGCGAGTTCATCAGCGAATC
>probe:Drosophila_2:1633189_at:656:417; Interrogation_Position=1320; Antisense; GAGCTATGGTAGTCTGCCACTGGAC
>probe:Drosophila_2:1633189_at:356:587; Interrogation_Position=1340; Antisense; TGGACCTCAACTACGATCCGGTGGA
>probe:Drosophila_2:1633189_at:525:67; Interrogation_Position=1372; Antisense; ATGGAACCACTGCTGGTGATCTCGC
>probe:Drosophila_2:1633189_at:326:261; Interrogation_Position=1409; Antisense; CACGCGGCTGTTGGCTGAGATTCGT
>probe:Drosophila_2:1633189_at:125:429; Interrogation_Position=1425; Antisense; GAGATTCGTTCGTTTGCTGCATCGC
>probe:Drosophila_2:1633189_at:305:659; Interrogation_Position=1523; Antisense; TAAACATCTTCAGCCTGGCCAGTCT
>probe:Drosophila_2:1633189_at:665:675; Interrogation_Position=1572; Antisense; TAGCAATCTGACCAAGCACTTCTGA

Paste this into a BLAST search page for me
AGTGTGCCCTTCTATGTGATGCTCATAGCTCCGCGATGTTCATGCAGATCGAGAACTACTTCAAACTACCGGAATTTCAGTGCTGGCCTTGGAGGTCCTACCTAGTGGCGGAGTTTGTGCCCAGTTGCCCAGTTTTGATGCCCTGATGGAAATGGAGCGAGTTCATCAGCGAATCGAGCTATGGTAGTCTGCCACTGGACTGGACCTCAACTACGATCCGGTGGAATGGAACCACTGCTGGTGATCTCGCCACGCGGCTGTTGGCTGAGATTCGTGAGATTCGTTCGTTTGCTGCATCGCTAAACATCTTCAGCCTGGCCAGTCTTAGCAATCTGACCAAGCACTTCTGA

Full Affymetrix probeset data:

Annotations for 1633189_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720