FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633190_at:

>probe:Drosophila_2:1633190_at:366:465; Interrogation_Position=235; Antisense; GATTGGTGACCCTGTTCTTAGGCAA
>probe:Drosophila_2:1633190_at:84:77; Interrogation_Position=279; Antisense; AGGAGCACATGGCTAGCCCCGAGAT
>probe:Drosophila_2:1633190_at:78:429; Interrogation_Position=299; Antisense; GAGATTAAGGCCATCGTCGAGCGGA
>probe:Drosophila_2:1633190_at:1:225; Interrogation_Position=337; Antisense; AAGGAAGTTCGACTGCGTCGGCATT
>probe:Drosophila_2:1633190_at:166:275; Interrogation_Position=358; Antisense; CATTGCGGCTCCTCAGATTGGAGTA
>probe:Drosophila_2:1633190_at:430:167; Interrogation_Position=459; Antisense; AAATGTCCGAGTTGCCACTGACTAT
>probe:Drosophila_2:1633190_at:330:611; Interrogation_Position=477; Antisense; TGACTATTTTCATCAATCCCGTCCT
>probe:Drosophila_2:1633190_at:219:611; Interrogation_Position=501; Antisense; TGACGGTGACCAACTACGCGAAGCT
>probe:Drosophila_2:1633190_at:337:433; Interrogation_Position=547; Antisense; GAGTGTGCGAGGTTACTCTGCCGAA
>probe:Drosophila_2:1633190_at:34:209; Interrogation_Position=593; Antisense; AAGCTAACAGGCCTTGACCAACTAG
>probe:Drosophila_2:1633190_at:103:235; Interrogation_Position=650; Antisense; AATGCCCGGATAGCGCAGCACGAAA
>probe:Drosophila_2:1633190_at:591:525; Interrogation_Position=688; Antisense; GGGAAAACTATACACCGATCACATG
>probe:Drosophila_2:1633190_at:592:617; Interrogation_Position=731; Antisense; TGCACCTGCTGGGAGGCGGTTAACA
>probe:Drosophila_2:1633190_at:41:135; Interrogation_Position=766; Antisense; ACGCGTGGAGATACCCTTCTACAAG

Paste this into a BLAST search page for me
GATTGGTGACCCTGTTCTTAGGCAAAGGAGCACATGGCTAGCCCCGAGATGAGATTAAGGCCATCGTCGAGCGGAAAGGAAGTTCGACTGCGTCGGCATTCATTGCGGCTCCTCAGATTGGAGTAAAATGTCCGAGTTGCCACTGACTATTGACTATTTTCATCAATCCCGTCCTTGACGGTGACCAACTACGCGAAGCTGAGTGTGCGAGGTTACTCTGCCGAAAAGCTAACAGGCCTTGACCAACTAGAATGCCCGGATAGCGCAGCACGAAAGGGAAAACTATACACCGATCACATGTGCACCTGCTGGGAGGCGGTTAACAACGCGTGGAGATACCCTTCTACAAG

Full Affymetrix probeset data:

Annotations for 1633190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720