FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633191_at:

>probe:Drosophila_2:1633191_at:397:723; Interrogation_Position=303; Antisense; TTGTAAAGGATGATGAGCGAGGACT
>probe:Drosophila_2:1633191_at:107:579; Interrogation_Position=356; Antisense; GGCCGAGATGCTGCGTCGAGCAGGA
>probe:Drosophila_2:1633191_at:352:281; Interrogation_Position=683; Antisense; CTCTGTACAATTGAGCTGCTAGCAA
>probe:Drosophila_2:1633191_at:660:607; Interrogation_Position=694; Antisense; TGAGCTGCTAGCAAGGCTTATGAAC
>probe:Drosophila_2:1633191_at:379:359; Interrogation_Position=704; Antisense; GCAAGGCTTATGAACTGACAAGTAA
>probe:Drosophila_2:1633191_at:372:391; Interrogation_Position=720; Antisense; GACAAGTAACTTATTCGAGGCTTAT
>probe:Drosophila_2:1633191_at:130:491; Interrogation_Position=725; Antisense; GTAACTTATTCGAGGCTTATCCCAT
>probe:Drosophila_2:1633191_at:516:9; Interrogation_Position=732; Antisense; ATTCGAGGCTTATCCCATGGCTGGA
>probe:Drosophila_2:1633191_at:673:703; Interrogation_Position=741; Antisense; TTATCCCATGGCTGGACCTTTCAAT
>probe:Drosophila_2:1633191_at:345:307; Interrogation_Position=746; Antisense; CCATGGCTGGACCTTTCAATGTATA
>probe:Drosophila_2:1633191_at:251:553; Interrogation_Position=754; Antisense; GGACCTTTCAATGTATAGCTAAGAC
>probe:Drosophila_2:1633191_at:350:673; Interrogation_Position=769; Antisense; TAGCTAAGACCATTAACCTATTAAA
>probe:Drosophila_2:1633191_at:262:203; Interrogation_Position=783; Antisense; AACCTATTAAATCCACTCTATCTTG
>probe:Drosophila_2:1633191_at:353:707; Interrogation_Position=789; Antisense; TTAAATCCACTCTATCTTGGTTAAT

Paste this into a BLAST search page for me
TTGTAAAGGATGATGAGCGAGGACTGGCCGAGATGCTGCGTCGAGCAGGACTCTGTACAATTGAGCTGCTAGCAATGAGCTGCTAGCAAGGCTTATGAACGCAAGGCTTATGAACTGACAAGTAAGACAAGTAACTTATTCGAGGCTTATGTAACTTATTCGAGGCTTATCCCATATTCGAGGCTTATCCCATGGCTGGATTATCCCATGGCTGGACCTTTCAATCCATGGCTGGACCTTTCAATGTATAGGACCTTTCAATGTATAGCTAAGACTAGCTAAGACCATTAACCTATTAAAAACCTATTAAATCCACTCTATCTTGTTAAATCCACTCTATCTTGGTTAAT

Full Affymetrix probeset data:

Annotations for 1633191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720