FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633193_at:

>probe:Drosophila_2:1633193_at:565:73; Interrogation_Position=139; Antisense; AGGAAACTCTATTCACTTGTTCAGT
>probe:Drosophila_2:1633193_at:693:543; Interrogation_Position=195; Antisense; GGATCAATTATGCACCAAGTCGACT
>probe:Drosophila_2:1633193_at:722:409; Interrogation_Position=222; Antisense; GACGACTCCTTCGATGTGTGGATGG
>probe:Drosophila_2:1633193_at:516:519; Interrogation_Position=239; Antisense; GTGGATGGATATTCTTCACTTCAAG
>probe:Drosophila_2:1633193_at:360:171; Interrogation_Position=291; Antisense; AAAGTGCGAACGAAGCCCTGCGATT
>probe:Drosophila_2:1633193_at:498:465; Interrogation_Position=312; Antisense; GATTGGTTCACCAACTACTTTGGTA
>probe:Drosophila_2:1633193_at:166:79; Interrogation_Position=358; Antisense; AGGATTCAAATCTACCGCCAATTCA
>probe:Drosophila_2:1633193_at:437:653; Interrogation_Position=380; Antisense; TCAAGAGATGTGTGTATTCCCAAAG
>probe:Drosophila_2:1633193_at:440:177; Interrogation_Position=443; Antisense; AAACTGGCCGCCGATTTTGTATCGA
>probe:Drosophila_2:1633193_at:157:699; Interrogation_Position=459; Antisense; TTGTATCGAGGCCTAAACCAATTCA
>probe:Drosophila_2:1633193_at:626:487; Interrogation_Position=511; Antisense; GTACTGGCGGGATTCAATTTGTCAT
>probe:Drosophila_2:1633193_at:664:559; Interrogation_Position=542; Antisense; GGAAGATTCCACATTATAGCCAAAT
>probe:Drosophila_2:1633193_at:61:471; Interrogation_Position=637; Antisense; GTTCATATCGGGAAGAGCCTGTTTC
>probe:Drosophila_2:1633193_at:240:415; Interrogation_Position=651; Antisense; GAGCCTGTTTCTAAGTACCATTTAA

Paste this into a BLAST search page for me
AGGAAACTCTATTCACTTGTTCAGTGGATCAATTATGCACCAAGTCGACTGACGACTCCTTCGATGTGTGGATGGGTGGATGGATATTCTTCACTTCAAGAAAGTGCGAACGAAGCCCTGCGATTGATTGGTTCACCAACTACTTTGGTAAGGATTCAAATCTACCGCCAATTCATCAAGAGATGTGTGTATTCCCAAAGAAACTGGCCGCCGATTTTGTATCGATTGTATCGAGGCCTAAACCAATTCAGTACTGGCGGGATTCAATTTGTCATGGAAGATTCCACATTATAGCCAAATGTTCATATCGGGAAGAGCCTGTTTCGAGCCTGTTTCTAAGTACCATTTAA

Full Affymetrix probeset data:

Annotations for 1633193_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720