FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633194_at:

>probe:Drosophila_2:1633194_at:440:473; Interrogation_Position=1006; Antisense; GTTCACATTTCGCATATCACACAAT
>probe:Drosophila_2:1633194_at:156:477; Interrogation_Position=1123; Antisense; GTTTTGTCAAAGCTTTTCGCTGCAA
>probe:Drosophila_2:1633194_at:297:19; Interrogation_Position=631; Antisense; ATTTGCGCTCAAACAATCTGCCCTA
>probe:Drosophila_2:1633194_at:335:151; Interrogation_Position=681; Antisense; ACATCTTTGGGAGATCGCAGCTCAA
>probe:Drosophila_2:1633194_at:505:307; Interrogation_Position=718; Antisense; CCAGTCTGCTGGCTTACGACGAAAA
>probe:Drosophila_2:1633194_at:311:681; Interrogation_Position=759; Antisense; TATCGACCGGCCTACGAATTGGAGA
>probe:Drosophila_2:1633194_at:219:111; Interrogation_Position=781; Antisense; AGAATGTGCGTCTTGAGCGGTTCAA
>probe:Drosophila_2:1633194_at:227:69; Interrogation_Position=823; Antisense; AGGCCTCAGTCAGCGGATCCAAACA
>probe:Drosophila_2:1633194_at:714:311; Interrogation_Position=858; Antisense; GCCAAAGTTCAGGTCAAGCGCAAAG
>probe:Drosophila_2:1633194_at:103:205; Interrogation_Position=873; Antisense; AAGCGCAAAGTTTCTGGCTCTGCTC
>probe:Drosophila_2:1633194_at:211:573; Interrogation_Position=888; Antisense; GGCTCTGCTCTTGACTTGATTTTCT
>probe:Drosophila_2:1633194_at:325:361; Interrogation_Position=953; Antisense; GCAAGTGTCAGCTAACTGGGCCGAC
>probe:Drosophila_2:1633194_at:3:397; Interrogation_Position=975; Antisense; GACAATTCTTCGTTGAGACCCCATT
>probe:Drosophila_2:1633194_at:556:103; Interrogation_Position=990; Antisense; AGACCCCATTTCACTTGTTCACATT

Paste this into a BLAST search page for me
GTTCACATTTCGCATATCACACAATGTTTTGTCAAAGCTTTTCGCTGCAAATTTGCGCTCAAACAATCTGCCCTAACATCTTTGGGAGATCGCAGCTCAACCAGTCTGCTGGCTTACGACGAAAATATCGACCGGCCTACGAATTGGAGAAGAATGTGCGTCTTGAGCGGTTCAAAGGCCTCAGTCAGCGGATCCAAACAGCCAAAGTTCAGGTCAAGCGCAAAGAAGCGCAAAGTTTCTGGCTCTGCTCGGCTCTGCTCTTGACTTGATTTTCTGCAAGTGTCAGCTAACTGGGCCGACGACAATTCTTCGTTGAGACCCCATTAGACCCCATTTCACTTGTTCACATT

Full Affymetrix probeset data:

Annotations for 1633194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720