FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633195_at:

>probe:Drosophila_2:1633195_at:729:155; Interrogation_Position=1035; Antisense; ACAGCCCGAGCAAAGTTTGTGGCCA
>probe:Drosophila_2:1633195_at:321:517; Interrogation_Position=1077; Antisense; GTGTCCACAGGACTCGCAAGGAAAT
>probe:Drosophila_2:1633195_at:384:355; Interrogation_Position=1109; Antisense; GCACGAAAGTCTTCTGCCCATGGAG
>probe:Drosophila_2:1633195_at:167:705; Interrogation_Position=1137; Antisense; TTACCTTTCACCTTTGACATGACAC
>probe:Drosophila_2:1633195_at:584:373; Interrogation_Position=626; Antisense; GAAGTTCTGTTTCGCATCAAAGGCC
>probe:Drosophila_2:1633195_at:365:257; Interrogation_Position=643; Antisense; CAAAGGCCCCTCTTATATGCAATAA
>probe:Drosophila_2:1633195_at:201:205; Interrogation_Position=689; Antisense; AAGCGCTCTGAGTAAATCCCGGAAA
>probe:Drosophila_2:1633195_at:325:389; Interrogation_Position=710; Antisense; GAAAACGCTACTGAAATGCCACGGG
>probe:Drosophila_2:1633195_at:430:553; Interrogation_Position=734; Antisense; GGAGCTATTGAAGTACACCCAGAAG
>probe:Drosophila_2:1633195_at:594:561; Interrogation_Position=797; Antisense; GGAACTTCCATCTATATCGGAGCTA
>probe:Drosophila_2:1633195_at:2:43; Interrogation_Position=812; Antisense; ATCGGAGCTATCGTTGCTGCTGGAC
>probe:Drosophila_2:1633195_at:240:229; Interrogation_Position=879; Antisense; AATGTCTTTGACACCTTAGCGGAGC
>probe:Drosophila_2:1633195_at:341:331; Interrogation_Position=897; Antisense; GCGGAGCTTCATTTTTCGTTTGACA
>probe:Drosophila_2:1633195_at:730:599; Interrogation_Position=978; Antisense; TGTCATGAACGAAACTCCTTCCGGG

Paste this into a BLAST search page for me
ACAGCCCGAGCAAAGTTTGTGGCCAGTGTCCACAGGACTCGCAAGGAAATGCACGAAAGTCTTCTGCCCATGGAGTTACCTTTCACCTTTGACATGACACGAAGTTCTGTTTCGCATCAAAGGCCCAAAGGCCCCTCTTATATGCAATAAAAGCGCTCTGAGTAAATCCCGGAAAGAAAACGCTACTGAAATGCCACGGGGGAGCTATTGAAGTACACCCAGAAGGGAACTTCCATCTATATCGGAGCTAATCGGAGCTATCGTTGCTGCTGGACAATGTCTTTGACACCTTAGCGGAGCGCGGAGCTTCATTTTTCGTTTGACATGTCATGAACGAAACTCCTTCCGGG

Full Affymetrix probeset data:

Annotations for 1633195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720