FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633196_at:

>probe:Drosophila_2:1633196_at:695:19; Interrogation_Position=1379; Antisense; ATTTGGCACGATACGCATCGCTTTA
>probe:Drosophila_2:1633196_at:694:319; Interrogation_Position=1435; Antisense; GCCCACCTATCTATATCGTTTTGAC
>probe:Drosophila_2:1633196_at:537:33; Interrogation_Position=1479; Antisense; ATCAATTTCGCCGACTGGTGTGCGG
>probe:Drosophila_2:1633196_at:471:39; Interrogation_Position=1506; Antisense; ATCGGATTCGCGGAGTAGCCCATGC
>probe:Drosophila_2:1633196_at:229:487; Interrogation_Position=1520; Antisense; GTAGCCCATGCGGATGAACTATCAT
>probe:Drosophila_2:1633196_at:481:603; Interrogation_Position=1548; Antisense; TGTTCTACAACATCATAGCCTCCAA
>probe:Drosophila_2:1633196_at:195:229; Interrogation_Position=1612; Antisense; AATGGTTGGCATGTGGACGTCGTTT
>probe:Drosophila_2:1633196_at:277:479; Interrogation_Position=1633; Antisense; GTTTGCCTCCAGTGGGAATCCAAAT
>probe:Drosophila_2:1633196_at:566:451; Interrogation_Position=1671; Antisense; GATCTGCCAAATGGGAAGCCGTCCA
>probe:Drosophila_2:1633196_at:434:373; Interrogation_Position=1717; Antisense; GAAGTGCTTCAACATTAGCCACGAT
>probe:Drosophila_2:1633196_at:428:445; Interrogation_Position=1747; Antisense; GATGCGAGATTTGCCGGAGTCCGAT
>probe:Drosophila_2:1633196_at:127:465; Interrogation_Position=1769; Antisense; GATTGCCTAGCCGTTTGGGATACAT
>probe:Drosophila_2:1633196_at:111:89; Interrogation_Position=1806; Antisense; AGTCGCTCTTCTAGTTCTCAAATCT
>probe:Drosophila_2:1633196_at:695:217; Interrogation_Position=1848; Antisense; AAGTGCTCCAGATGTTCTACGAAGT

Paste this into a BLAST search page for me
ATTTGGCACGATACGCATCGCTTTAGCCCACCTATCTATATCGTTTTGACATCAATTTCGCCGACTGGTGTGCGGATCGGATTCGCGGAGTAGCCCATGCGTAGCCCATGCGGATGAACTATCATTGTTCTACAACATCATAGCCTCCAAAATGGTTGGCATGTGGACGTCGTTTGTTTGCCTCCAGTGGGAATCCAAATGATCTGCCAAATGGGAAGCCGTCCAGAAGTGCTTCAACATTAGCCACGATGATGCGAGATTTGCCGGAGTCCGATGATTGCCTAGCCGTTTGGGATACATAGTCGCTCTTCTAGTTCTCAAATCTAAGTGCTCCAGATGTTCTACGAAGT

Full Affymetrix probeset data:

Annotations for 1633196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720