Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633197_at:

>probe:Drosophila_2:1633197_at:177:61; Interrogation_Position=104; Antisense; ATGTAGCCTGCGTGTCCAAGAATCA
>probe:Drosophila_2:1633197_at:160:633; Interrogation_Position=142; Antisense; TCGGCAAACGCTATTCCTACAGGTA
>probe:Drosophila_2:1633197_at:600:153; Interrogation_Position=160; Antisense; ACAGGTACCGTGTATACATGTCCAA
>probe:Drosophila_2:1633197_at:674:567; Interrogation_Position=20; Antisense; GGCACCTGCTCTTTTCAGTATTTTT
>probe:Drosophila_2:1633197_at:19:395; Interrogation_Position=213; Antisense; GAAATGCACTTCCAACGAGGCTTTT
>probe:Drosophila_2:1633197_at:579:287; Interrogation_Position=267; Antisense; CGGAATTATACCATTCGCCTGTACT
>probe:Drosophila_2:1633197_at:418:111; Interrogation_Position=337; Antisense; AGCAATGAATATCCCTGTTCGACAG
>probe:Drosophila_2:1633197_at:254:91; Interrogation_Position=36; Antisense; AGTATTTTTGTTGGCCACTCTAGTG
>probe:Drosophila_2:1633197_at:239:249; Interrogation_Position=381; Antisense; AATTGGCAATCCTTGTGTGGCCTCA
>probe:Drosophila_2:1633197_at:153:515; Interrogation_Position=426; Antisense; GTGTTCCCAGTATGCTTTAATCGAT
>probe:Drosophila_2:1633197_at:608:375; Interrogation_Position=458; Antisense; GTATCCAAAAGAGCTCCACGGGTCG
>probe:Drosophila_2:1633197_at:469:635; Interrogation_Position=480; Antisense; TCGCTTTCCTTATCCCAATGATTTA
>probe:Drosophila_2:1633197_at:473:699; Interrogation_Position=64; Antisense; TTTAGCCAGGCCGAGTGCAATATCT
>probe:Drosophila_2:1633197_at:265:363; Interrogation_Position=80; Antisense; GCAATATCTGTTCCTCTGAGAGCAA

Paste this into a BLAST search page for me
ATGTAGCCTGCGTGTCCAAGAATCATCGGCAAACGCTATTCCTACAGGTAACAGGTACCGTGTATACATGTCCAAGGCACCTGCTCTTTTCAGTATTTTTGAAATGCACTTCCAACGAGGCTTTTCGGAATTATACCATTCGCCTGTACTAGCAATGAATATCCCTGTTCGACAGAGTATTTTTGTTGGCCACTCTAGTGAATTGGCAATCCTTGTGTGGCCTCAGTGTTCCCAGTATGCTTTAATCGATGTATCCAAAAGAGCTCCACGGGTCGTCGCTTTCCTTATCCCAATGATTTATTTAGCCAGGCCGAGTGCAATATCTGCAATATCTGTTCCTCTGAGAGCAA

Full Affymetrix probeset data:

Annotations for 1633197_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime