FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633199_at:

>probe:Drosophila_2:1633199_at:86:599; Interrogation_Position=1018; Antisense; TGTCCGTACGAGTCACCCGAGTGCG
>probe:Drosophila_2:1633199_at:645:583; Interrogation_Position=1072; Antisense; TGGAATACCCACTGCGGCCCAGTTG
>probe:Drosophila_2:1633199_at:617:265; Interrogation_Position=1091; Antisense; CAGTTGGTCCTTGCGGTCCTCAAGT
>probe:Drosophila_2:1633199_at:618:279; Interrogation_Position=1109; Antisense; CTCAAGTGCCTTGTGGACCCAGCGG
>probe:Drosophila_2:1633199_at:146:577; Interrogation_Position=1132; Antisense; GGCCCCTGTTAACATCATCGTTGTG
>probe:Drosophila_2:1633199_at:254:151; Interrogation_Position=1143; Antisense; ACATCATCGTTGTGCTGCCTGGATT
>probe:Drosophila_2:1633199_at:710:539; Interrogation_Position=1163; Antisense; GGATTGTTGTCAGAAACCGGTGCCC
>probe:Drosophila_2:1633199_at:215:391; Interrogation_Position=1175; Antisense; GAAACCGGTGCCCAGTGGACCAACT
>probe:Drosophila_2:1633199_at:89:521; Interrogation_Position=1189; Antisense; GTGGACCAACTTGTCTATCACCAAT
>probe:Drosophila_2:1633199_at:374:9; Interrogation_Position=1218; Antisense; ATTGCCATAGTGTATTCTCGCCGTT
>probe:Drosophila_2:1633199_at:396:471; Interrogation_Position=1240; Antisense; GTTCTGCTCAAACACCACCAAAAAA
>probe:Drosophila_2:1633199_at:102:473; Interrogation_Position=1272; Antisense; GTTCTCTATACTTTGTCAACGCATG
>probe:Drosophila_2:1633199_at:72:197; Interrogation_Position=1289; Antisense; AACGCATGGACGACTCATTGGCTGT
>probe:Drosophila_2:1633199_at:528:61; Interrogation_Position=954; Antisense; ATGTGGACCGCTCGGCAATAGTCCT

Paste this into a BLAST search page for me
TGTCCGTACGAGTCACCCGAGTGCGTGGAATACCCACTGCGGCCCAGTTGCAGTTGGTCCTTGCGGTCCTCAAGTCTCAAGTGCCTTGTGGACCCAGCGGGGCCCCTGTTAACATCATCGTTGTGACATCATCGTTGTGCTGCCTGGATTGGATTGTTGTCAGAAACCGGTGCCCGAAACCGGTGCCCAGTGGACCAACTGTGGACCAACTTGTCTATCACCAATATTGCCATAGTGTATTCTCGCCGTTGTTCTGCTCAAACACCACCAAAAAAGTTCTCTATACTTTGTCAACGCATGAACGCATGGACGACTCATTGGCTGTATGTGGACCGCTCGGCAATAGTCCT

Full Affymetrix probeset data:

Annotations for 1633199_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720