FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633200_at:

>probe:Drosophila_2:1633200_at:427:533; Interrogation_Position=1021; Antisense; GGTGGAGATCTACTTCCGCAACGAT
>probe:Drosophila_2:1633200_at:562:223; Interrogation_Position=1106; Antisense; AAGGTGCTCGAATTCGCCAAGGACG
>probe:Drosophila_2:1633200_at:545:139; Interrogation_Position=1121; Antisense; GCCAAGGACGTTGTTCCCACGGAAG
>probe:Drosophila_2:1633200_at:285:445; Interrogation_Position=1148; Antisense; GATGACAAGCGGTGCGAGTCTCGCA
>probe:Drosophila_2:1633200_at:510:431; Interrogation_Position=1163; Antisense; GAGTCTCGCAATGAAGCCTTCACAG
>probe:Drosophila_2:1633200_at:194:429; Interrogation_Position=701; Antisense; GAGTTGCCAGAATGGACGCACGCAT
>probe:Drosophila_2:1633200_at:280:551; Interrogation_Position=733; Antisense; GGAGAAGCTTCAGTTCCTCGCCGAA
>probe:Drosophila_2:1633200_at:21:387; Interrogation_Position=755; Antisense; GAACAGAGCTACATCTACAACGTGT
>probe:Drosophila_2:1633200_at:519:653; Interrogation_Position=801; Antisense; TCAAGGGCGGACCTTTTCTCAAGAA
>probe:Drosophila_2:1633200_at:370:201; Interrogation_Position=867; Antisense; AACCCAGTGGCAGGAAGCTCTTCAT
>probe:Drosophila_2:1633200_at:349:563; Interrogation_Position=879; Antisense; GGAAGCTCTTCATCTACGCTGGTCA
>probe:Drosophila_2:1633200_at:357:137; Interrogation_Position=903; Antisense; ACGACTCGACGGTGGTGAATGTACT
>probe:Drosophila_2:1633200_at:191:615; Interrogation_Position=918; Antisense; TGAATGTACTTTCCGCCCTGAAGAT
>probe:Drosophila_2:1633200_at:532:293; Interrogation_Position=972; Antisense; CGATGATCCTGTTTGAGCTGCACAA

Paste this into a BLAST search page for me
GGTGGAGATCTACTTCCGCAACGATAAGGTGCTCGAATTCGCCAAGGACGGCCAAGGACGTTGTTCCCACGGAAGGATGACAAGCGGTGCGAGTCTCGCAGAGTCTCGCAATGAAGCCTTCACAGGAGTTGCCAGAATGGACGCACGCATGGAGAAGCTTCAGTTCCTCGCCGAAGAACAGAGCTACATCTACAACGTGTTCAAGGGCGGACCTTTTCTCAAGAAAACCCAGTGGCAGGAAGCTCTTCATGGAAGCTCTTCATCTACGCTGGTCAACGACTCGACGGTGGTGAATGTACTTGAATGTACTTTCCGCCCTGAAGATCGATGATCCTGTTTGAGCTGCACAA

Full Affymetrix probeset data:

Annotations for 1633200_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720