FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633201_at:

>probe:Drosophila_2:1633201_at:154:319; Interrogation_Position=1023; Antisense; GCCGAGCACGTTAAGATTTACACCA
>probe:Drosophila_2:1633201_at:170:163; Interrogation_Position=1047; Antisense; AAATATCCCAAGCAGTACGTCCAGT
>probe:Drosophila_2:1633201_at:87:563; Interrogation_Position=1090; Antisense; GGAACTGCATGACAATTCCTCCTCT
>probe:Drosophila_2:1633201_at:202:333; Interrogation_Position=1122; Antisense; GCTGTTAATTCTGAGCCATCCGAAA
>probe:Drosophila_2:1633201_at:342:377; Interrogation_Position=1194; Antisense; GAAGCACAACTAGTTTCTCGTATGA
>probe:Drosophila_2:1633201_at:409:181; Interrogation_Position=746; Antisense; AAAACGCTGCAACTGTTTGGCCGCA
>probe:Drosophila_2:1633201_at:49:481; Interrogation_Position=760; Antisense; GTTTGGCCGCACTGGTTATAACCAT
>probe:Drosophila_2:1633201_at:306:549; Interrogation_Position=809; Antisense; GGAGGAATCAATTTCTGCCTTGAAA
>probe:Drosophila_2:1633201_at:361:723; Interrogation_Position=828; Antisense; TTGAAAAGCCTATTCGTGCCGTCTT
>probe:Drosophila_2:1633201_at:705:175; Interrogation_Position=887; Antisense; AAACGAAGCCAATAGATACCCACAG
>probe:Drosophila_2:1633201_at:333:673; Interrogation_Position=903; Antisense; TACCCACAGCTTTTTCTGTATTCGA
>probe:Drosophila_2:1633201_at:531:511; Interrogation_Position=931; Antisense; GTGACATTGTGATTCCCTATCGAGA
>probe:Drosophila_2:1633201_at:490:277; Interrogation_Position=972; Antisense; CGTCTTAGACGCGATCAGGGTATTC
>probe:Drosophila_2:1633201_at:709:267; Interrogation_Position=987; Antisense; CAGGGTATTCAGGTATCGTCAGTAT

Paste this into a BLAST search page for me
GCCGAGCACGTTAAGATTTACACCAAAATATCCCAAGCAGTACGTCCAGTGGAACTGCATGACAATTCCTCCTCTGCTGTTAATTCTGAGCCATCCGAAAGAAGCACAACTAGTTTCTCGTATGAAAAACGCTGCAACTGTTTGGCCGCAGTTTGGCCGCACTGGTTATAACCATGGAGGAATCAATTTCTGCCTTGAAATTGAAAAGCCTATTCGTGCCGTCTTAAACGAAGCCAATAGATACCCACAGTACCCACAGCTTTTTCTGTATTCGAGTGACATTGTGATTCCCTATCGAGACGTCTTAGACGCGATCAGGGTATTCCAGGGTATTCAGGTATCGTCAGTAT

Full Affymetrix probeset data:

Annotations for 1633201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720