FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633205_at:

>probe:Drosophila_2:1633205_at:433:1; Interrogation_Position=2503; Antisense; CTTGTAGTTCGTATGGTTAATGCCC
>probe:Drosophila_2:1633205_at:453:625; Interrogation_Position=2523; Antisense; TGCCCAGTTATAGCATACTCATATA
>probe:Drosophila_2:1633205_at:237:507; Interrogation_Position=2583; Antisense; GTGCGAAACACTTGTCAGTTAATCT
>probe:Drosophila_2:1633205_at:122:93; Interrogation_Position=2599; Antisense; AGTTAATCTATCGAGAACTCCTTGA
>probe:Drosophila_2:1633205_at:693:243; Interrogation_Position=2648; Antisense; AATTAACGACACGATCGAGGCTCAA
>probe:Drosophila_2:1633205_at:330:293; Interrogation_Position=2663; Antisense; CGAGGCTCAAAATTATTGGGCACAT
>probe:Drosophila_2:1633205_at:18:729; Interrogation_Position=2678; Antisense; TTGGGCACATAATCTGTACATACAC
>probe:Drosophila_2:1633205_at:314:187; Interrogation_Position=2727; Antisense; AACACGTTATAGGATATCTCATGGA
>probe:Drosophila_2:1633205_at:426:183; Interrogation_Position=2760; Antisense; AAAAGCTGCCAGAGTTGAACTACAA
>probe:Drosophila_2:1633205_at:197:167; Interrogation_Position=2784; Antisense; AAATCCGCTCAAACAGCCATGAGGG
>probe:Drosophila_2:1633205_at:6:193; Interrogation_Position=2866; Antisense; AACTACGATTGTTTGCTTAAAGCAG
>probe:Drosophila_2:1633205_at:680:99; Interrogation_Position=2988; Antisense; AGAGTTTCTTTCACGCTGAAGCGGA
>probe:Drosophila_2:1633205_at:656:613; Interrogation_Position=3004; Antisense; TGAAGCGGAACTAACAGCCATGAGT
>probe:Drosophila_2:1633205_at:708:261; Interrogation_Position=3018; Antisense; CAGCCATGAGTTCTGTTTCAATTTG

Paste this into a BLAST search page for me
CTTGTAGTTCGTATGGTTAATGCCCTGCCCAGTTATAGCATACTCATATAGTGCGAAACACTTGTCAGTTAATCTAGTTAATCTATCGAGAACTCCTTGAAATTAACGACACGATCGAGGCTCAACGAGGCTCAAAATTATTGGGCACATTTGGGCACATAATCTGTACATACACAACACGTTATAGGATATCTCATGGAAAAAGCTGCCAGAGTTGAACTACAAAAATCCGCTCAAACAGCCATGAGGGAACTACGATTGTTTGCTTAAAGCAGAGAGTTTCTTTCACGCTGAAGCGGATGAAGCGGAACTAACAGCCATGAGTCAGCCATGAGTTCTGTTTCAATTTG

Full Affymetrix probeset data:

Annotations for 1633205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720