Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633207_at:

>probe:Drosophila_2:1633207_at:544:565; Interrogation_Position=118; Antisense; GGCACCAAGGGACCCACAGTGAACA
>probe:Drosophila_2:1633207_at:554:153; Interrogation_Position=133; Antisense; ACAGTGAACATTCCCCAGGAGGCTG
>probe:Drosophila_2:1633207_at:427:77; Interrogation_Position=149; Antisense; AGGAGGCTGTCAATCGCACCGCAGT
>probe:Drosophila_2:1633207_at:599:131; Interrogation_Position=166; Antisense; ACCGCAGTCTGGCAGCAGATCAACA
>probe:Drosophila_2:1633207_at:538:67; Interrogation_Position=194; Antisense; ATGGCAACGGCATCTCGGAGCAACT
>probe:Drosophila_2:1633207_at:730:425; Interrogation_Position=219; Antisense; GATCATACCAGTCACCCTTAAAGTC
>probe:Drosophila_2:1633207_at:250:219; Interrogation_Position=239; Antisense; AAGTCCGCCAGATCAATGGCAACCA
>probe:Drosophila_2:1633207_at:643:695; Interrogation_Position=296; Antisense; TTTCGCCCATGCACGAGGCGGATGA
>probe:Drosophila_2:1633207_at:264:489; Interrogation_Position=321; Antisense; GTACAGTGAAGCTCCGACCAATAGT
>probe:Drosophila_2:1633207_at:635:269; Interrogation_Position=352; Antisense; CATCCGGCGGGCAATCAGCAGCAGC
>probe:Drosophila_2:1633207_at:680:311; Interrogation_Position=409; Antisense; GCCAAATTGGATGGATCCTGCTCAA
>probe:Drosophila_2:1633207_at:716:187; Interrogation_Position=436; Antisense; AACAGTCAGATTAGTCCGGCCAACA
>probe:Drosophila_2:1633207_at:70:523; Interrogation_Position=50; Antisense; GGGCCAACTACAATGCCGATAAGTC
>probe:Drosophila_2:1633207_at:181:235; Interrogation_Position=61; Antisense; AATGCCGATAAGTCGGGTCCCACGA

Paste this into a BLAST search page for me
GGCACCAAGGGACCCACAGTGAACAACAGTGAACATTCCCCAGGAGGCTGAGGAGGCTGTCAATCGCACCGCAGTACCGCAGTCTGGCAGCAGATCAACAATGGCAACGGCATCTCGGAGCAACTGATCATACCAGTCACCCTTAAAGTCAAGTCCGCCAGATCAATGGCAACCATTTCGCCCATGCACGAGGCGGATGAGTACAGTGAAGCTCCGACCAATAGTCATCCGGCGGGCAATCAGCAGCAGCGCCAAATTGGATGGATCCTGCTCAAAACAGTCAGATTAGTCCGGCCAACAGGGCCAACTACAATGCCGATAAGTCAATGCCGATAAGTCGGGTCCCACGA

Full Affymetrix probeset data:

Annotations for 1633207_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime