FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633208_at:

>probe:Drosophila_2:1633208_at:590:223; Interrogation_Position=103; Antisense; AAGGATTTCGTACCCCTTCAGCTGG
>probe:Drosophila_2:1633208_at:678:301; Interrogation_Position=116; Antisense; CCCTTCAGCTGGTGCGGCTGAGAGA
>probe:Drosophila_2:1633208_at:108:57; Interrogation_Position=13; Antisense; ATGACGTCTCCCTTCGACGGCATTG
>probe:Drosophila_2:1633208_at:380:327; Interrogation_Position=170; Antisense; GCGAGTGCACCCTGGGAGCCATCAG
>probe:Drosophila_2:1633208_at:97:593; Interrogation_Position=182; Antisense; TGGGAGCCATCAGCATTCGTTATCT
>probe:Drosophila_2:1633208_at:34:263; Interrogation_Position=192; Antisense; CAGCATTCGTTATCTGGCACTATAG
>probe:Drosophila_2:1633208_at:211:407; Interrogation_Position=28; Antisense; GACGGCATTGCCTGCTTCTGGCTGT
>probe:Drosophila_2:1633208_at:264:619; Interrogation_Position=40; Antisense; TGCTTCTGGCTGTCACTAGTCTGGA
>probe:Drosophila_2:1633208_at:682:287; Interrogation_Position=45; Antisense; CTGGCTGTCACTAGTCTGGATTCAA
>probe:Drosophila_2:1633208_at:624:493; Interrogation_Position=51; Antisense; GTCACTAGTCTGGATTCAACTGGGT
>probe:Drosophila_2:1633208_at:467:499; Interrogation_Position=58; Antisense; GTCTGGATTCAACTGGGTATCATCA
>probe:Drosophila_2:1633208_at:706:195; Interrogation_Position=68; Antisense; AACTGGGTATCATCAATGCCGGCCT
>probe:Drosophila_2:1633208_at:466:539; Interrogation_Position=73; Antisense; GGTATCATCAATGCCGGCCTGGAGT
>probe:Drosophila_2:1633208_at:157:629; Interrogation_Position=98; Antisense; TCCTCAAGGATTTCGTACCCCTTCA

Paste this into a BLAST search page for me
AAGGATTTCGTACCCCTTCAGCTGGCCCTTCAGCTGGTGCGGCTGAGAGAATGACGTCTCCCTTCGACGGCATTGGCGAGTGCACCCTGGGAGCCATCAGTGGGAGCCATCAGCATTCGTTATCTCAGCATTCGTTATCTGGCACTATAGGACGGCATTGCCTGCTTCTGGCTGTTGCTTCTGGCTGTCACTAGTCTGGACTGGCTGTCACTAGTCTGGATTCAAGTCACTAGTCTGGATTCAACTGGGTGTCTGGATTCAACTGGGTATCATCAAACTGGGTATCATCAATGCCGGCCTGGTATCATCAATGCCGGCCTGGAGTTCCTCAAGGATTTCGTACCCCTTCA

Full Affymetrix probeset data:

Annotations for 1633208_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720