FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633210_at:

>probe:Drosophila_2:1633210_at:694:447; Interrogation_Position=108; Antisense; GATGCCGGATTACATGAACATTCTG
>probe:Drosophila_2:1633210_at:537:189; Interrogation_Position=124; Antisense; AACATTCTGGGCATGATTTTCTCCA
>probe:Drosophila_2:1633210_at:347:55; Interrogation_Position=13; Antisense; ATGAACATGACCGTGGATCCGCGCC
>probe:Drosophila_2:1633210_at:431:461; Interrogation_Position=138; Antisense; GATTTTCTCCATGTGTGGACTGATG
>probe:Drosophila_2:1633210_at:358:505; Interrogation_Position=177; Antisense; GTGCGCCTGGTTTGCGCTGTACTGC
>probe:Drosophila_2:1633210_at:346:601; Interrogation_Position=194; Antisense; TGTACTGCTCCTGCATTAGTTTCGC
>probe:Drosophila_2:1633210_at:686:1; Interrogation_Position=208; Antisense; ATTAGTTTCGCCAGTTCTCGGGCCA
>probe:Drosophila_2:1633210_at:582:325; Interrogation_Position=233; Antisense; GCGACGATGCCAAACAGGTGCTCTC
>probe:Drosophila_2:1633210_at:232:81; Interrogation_Position=248; Antisense; AGGTGCTCTCCTCCTTTATGTTGAG
>probe:Drosophila_2:1633210_at:445:305; Interrogation_Position=260; Antisense; CCTTTATGTTGAGCGTCAGTGCGGT
>probe:Drosophila_2:1633210_at:388:533; Interrogation_Position=282; Antisense; GGTGGTGATGTCCTACCTCCAGAAT
>probe:Drosophila_2:1633210_at:166:47; Interrogation_Position=29; Antisense; ATCCGCGCCGCAAGGAGAAGATCAA
>probe:Drosophila_2:1633210_at:496:95; Interrogation_Position=47; Antisense; AGATCAACCGCTACAAGGCGCCCAA
>probe:Drosophila_2:1633210_at:291:311; Interrogation_Position=94; Antisense; GCCAACGAGGACATGATGCCGGATT

Paste this into a BLAST search page for me
GATGCCGGATTACATGAACATTCTGAACATTCTGGGCATGATTTTCTCCAATGAACATGACCGTGGATCCGCGCCGATTTTCTCCATGTGTGGACTGATGGTGCGCCTGGTTTGCGCTGTACTGCTGTACTGCTCCTGCATTAGTTTCGCATTAGTTTCGCCAGTTCTCGGGCCAGCGACGATGCCAAACAGGTGCTCTCAGGTGCTCTCCTCCTTTATGTTGAGCCTTTATGTTGAGCGTCAGTGCGGTGGTGGTGATGTCCTACCTCCAGAATATCCGCGCCGCAAGGAGAAGATCAAAGATCAACCGCTACAAGGCGCCCAAGCCAACGAGGACATGATGCCGGATT

Full Affymetrix probeset data:

Annotations for 1633210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720