FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633213_at:

>probe:Drosophila_2:1633213_at:370:71; Interrogation_Position=1031; Antisense; AGTCCGTAATGCTCCAAGTGCCGGG
>probe:Drosophila_2:1633213_at:559:217; Interrogation_Position=1046; Antisense; AAGTGCCGGGCCTGTCCAATGTGGT
>probe:Drosophila_2:1633213_at:618:229; Interrogation_Position=1063; Antisense; AATGTGGTGACCTCTGGACCGCCGA
>probe:Drosophila_2:1633213_at:5:473; Interrogation_Position=1093; Antisense; GTTCTTTGCTTGCTCAACATGGTCA
>probe:Drosophila_2:1633213_at:345:585; Interrogation_Position=1208; Antisense; TGGAAATTCCACGTCCCATCGAGGG
>probe:Drosophila_2:1633213_at:597:331; Interrogation_Position=1250; Antisense; GCGGCAAGGTCTTTGTCGAATTCAA
>probe:Drosophila_2:1633213_at:613:245; Interrogation_Position=1268; Antisense; AATTCAACTCGGTTCTCGACTGTCA
>probe:Drosophila_2:1633213_at:231:577; Interrogation_Position=1296; Antisense; GGCGCAGCAAGCACTTACTGGACGT
>probe:Drosophila_2:1633213_at:721:555; Interrogation_Position=1315; Antisense; GGACGTAAATTCAGCGACCGCGTTG
>probe:Drosophila_2:1633213_at:215:519; Interrogation_Position=1339; Antisense; GTGGTCACATCATATTTCGATCCCG
>probe:Drosophila_2:1633213_at:200:695; Interrogation_Position=1353; Antisense; TTTCGATCCCGACAAATACCACAGA
>probe:Drosophila_2:1633213_at:195:281; Interrogation_Position=1409; Antisense; CTCACATTCACCATTTGTCCAATAA
>probe:Drosophila_2:1633213_at:440:655; Interrogation_Position=855; Antisense; TAAGGATGCCGCTACTGGGTTGAGT
>probe:Drosophila_2:1633213_at:581:265; Interrogation_Position=920; Antisense; CAGATCAGTCGATTGCTGGCCTAAA

Paste this into a BLAST search page for me
AGTCCGTAATGCTCCAAGTGCCGGGAAGTGCCGGGCCTGTCCAATGTGGTAATGTGGTGACCTCTGGACCGCCGAGTTCTTTGCTTGCTCAACATGGTCATGGAAATTCCACGTCCCATCGAGGGGCGGCAAGGTCTTTGTCGAATTCAAAATTCAACTCGGTTCTCGACTGTCAGGCGCAGCAAGCACTTACTGGACGTGGACGTAAATTCAGCGACCGCGTTGGTGGTCACATCATATTTCGATCCCGTTTCGATCCCGACAAATACCACAGACTCACATTCACCATTTGTCCAATAATAAGGATGCCGCTACTGGGTTGAGTCAGATCAGTCGATTGCTGGCCTAAA

Full Affymetrix probeset data:

Annotations for 1633213_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720