Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633214_at:

>probe:Drosophila_2:1633214_at:80:397; Interrogation_Position=2961; Antisense; GACAACTTCCAAAACAACTACCACA
>probe:Drosophila_2:1633214_at:557:413; Interrogation_Position=3022; Antisense; GAGCCAACAACTCCAAAGACCACTA
>probe:Drosophila_2:1633214_at:422:213; Interrogation_Position=3037; Antisense; AAGACCACTACTACCGAGTCAACCA
>probe:Drosophila_2:1633214_at:79:395; Interrogation_Position=3174; Antisense; GACAGTTTCAACAACCCCAACGACA
>probe:Drosophila_2:1633214_at:240:365; Interrogation_Position=3307; Antisense; GAATCGACAACCACAGTTTCTACAC
>probe:Drosophila_2:1633214_at:65:661; Interrogation_Position=3327; Antisense; TACACCAACAACTCTAGATCCGTAC
>probe:Drosophila_2:1633214_at:311:243; Interrogation_Position=3358; Antisense; AATATATGCTGTGGCCAAGCTCTTG
>probe:Drosophila_2:1633214_at:372:207; Interrogation_Position=3374; Antisense; AAGCTCTTGGAACTCTGCTTCCGTA
>probe:Drosophila_2:1633214_at:147:719; Interrogation_Position=3392; Antisense; TTCCGTATCCCAATGATTGCGGTCG
>probe:Drosophila_2:1633214_at:465:5; Interrogation_Position=3407; Antisense; ATTGCGGTCGCTATGTCGTCTGTGA
>probe:Drosophila_2:1633214_at:227:499; Interrogation_Position=3424; Antisense; GTCTGTGACTATCCCATTCCATATG
>probe:Drosophila_2:1633214_at:458:9; Interrogation_Position=3439; Antisense; ATTCCATATGCCGTGGATTGCGATG
>probe:Drosophila_2:1633214_at:531:455; Interrogation_Position=3481; Antisense; GATAATCTTCTTCAATGCACCTCTG
>probe:Drosophila_2:1633214_at:438:53; Interrogation_Position=3495; Antisense; ATGCACCTCTGTTCCCAATGAAAGG

Paste this into a BLAST search page for me
GACAACTTCCAAAACAACTACCACAGAGCCAACAACTCCAAAGACCACTAAAGACCACTACTACCGAGTCAACCAGACAGTTTCAACAACCCCAACGACAGAATCGACAACCACAGTTTCTACACTACACCAACAACTCTAGATCCGTACAATATATGCTGTGGCCAAGCTCTTGAAGCTCTTGGAACTCTGCTTCCGTATTCCGTATCCCAATGATTGCGGTCGATTGCGGTCGCTATGTCGTCTGTGAGTCTGTGACTATCCCATTCCATATGATTCCATATGCCGTGGATTGCGATGGATAATCTTCTTCAATGCACCTCTGATGCACCTCTGTTCCCAATGAAAGG

Full Affymetrix probeset data:

Annotations for 1633214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime