Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633215_at:

>probe:Drosophila_2:1633215_at:682:655; Interrogation_Position=1721; Antisense; TAATCTTGCTTCTCTCTTGCAGAAT
>probe:Drosophila_2:1633215_at:444:723; Interrogation_Position=1737; Antisense; TTGCAGAATCGCCAATCGCGCACAG
>probe:Drosophila_2:1633215_at:330:357; Interrogation_Position=1756; Antisense; GCACAGGTCGTTCCATTTTGGTCTA
>probe:Drosophila_2:1633215_at:118:701; Interrogation_Position=1771; Antisense; TTTTGGTCTACCAGCGCTTGAAGAA
>probe:Drosophila_2:1633215_at:191:233; Interrogation_Position=1806; Antisense; AATGCATTTAATCGCGGGCCGGATT
>probe:Drosophila_2:1633215_at:436:11; Interrogation_Position=1828; Antisense; ATTCAGGACAGCACGAGCCGGATGT
>probe:Drosophila_2:1633215_at:341:589; Interrogation_Position=1870; Antisense; TGGAGGATCTCGTCCTGGCCAACGA
>probe:Drosophila_2:1633215_at:122:411; Interrogation_Position=1947; Antisense; GACGCCCTCCGTTCAAAAGCAAGAA
>probe:Drosophila_2:1633215_at:597:601; Interrogation_Position=2017; Antisense; TGTATCCATTTTTGGCCTTAGCAAA
>probe:Drosophila_2:1633215_at:426:137; Interrogation_Position=2052; Antisense; ACGTTGTCGCCCGAAGAGAACAGAA
>probe:Drosophila_2:1633215_at:449:11; Interrogation_Position=2095; Antisense; ATTCGTAGGCGCATGTTGTGTACTC
>probe:Drosophila_2:1633215_at:510:467; Interrogation_Position=2109; Antisense; GTTGTGTACTCTGTGCTAGTTGCTA
>probe:Drosophila_2:1633215_at:135:205; Interrogation_Position=2140; Antisense; AAGCCATCTGAGTATTTAGACGCTA
>probe:Drosophila_2:1633215_at:541:187; Interrogation_Position=2193; Antisense; AACACACTTGATCTGTCCTTTCTTT

Paste this into a BLAST search page for me
TAATCTTGCTTCTCTCTTGCAGAATTTGCAGAATCGCCAATCGCGCACAGGCACAGGTCGTTCCATTTTGGTCTATTTTGGTCTACCAGCGCTTGAAGAAAATGCATTTAATCGCGGGCCGGATTATTCAGGACAGCACGAGCCGGATGTTGGAGGATCTCGTCCTGGCCAACGAGACGCCCTCCGTTCAAAAGCAAGAATGTATCCATTTTTGGCCTTAGCAAAACGTTGTCGCCCGAAGAGAACAGAAATTCGTAGGCGCATGTTGTGTACTCGTTGTGTACTCTGTGCTAGTTGCTAAAGCCATCTGAGTATTTAGACGCTAAACACACTTGATCTGTCCTTTCTTT

Full Affymetrix probeset data:

Annotations for 1633215_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime