FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633216_at:

>probe:Drosophila_2:1633216_at:73:709; Interrogation_Position=1060; Antisense; TTAAGCCGTCTGAACTTCTTCGAGT
>probe:Drosophila_2:1633216_at:708:635; Interrogation_Position=1079; Antisense; TCGAGTTTCGCGTTAGACCCTTGGG
>probe:Drosophila_2:1633216_at:249:435; Interrogation_Position=1123; Antisense; GAGGTCATCTTGCTGTTTCTGTCAA
>probe:Drosophila_2:1633216_at:244:485; Interrogation_Position=1148; Antisense; GTATGATCACCTACTTTACCTATGT
>probe:Drosophila_2:1633216_at:397:675; Interrogation_Position=611; Antisense; TAGCCGCTCTTTATTCCGAGGTGAA
>probe:Drosophila_2:1633216_at:629:433; Interrogation_Position=628; Antisense; GAGGTGAATAGCTTCGCCCGTATCG
>probe:Drosophila_2:1633216_at:657:417; Interrogation_Position=652; Antisense; GAGCTACGTCGGCAATTGAGATCCT
>probe:Drosophila_2:1633216_at:158:427; Interrogation_Position=669; Antisense; GAGATCCTTGGAACGTCCTGTCGGA
>probe:Drosophila_2:1633216_at:97:289; Interrogation_Position=690; Antisense; CGGAGGTCCTGTTGGTCGCAAGCAA
>probe:Drosophila_2:1633216_at:227:47; Interrogation_Position=871; Antisense; ATCCGGCCGGAGTTGTACGCAAGAA
>probe:Drosophila_2:1633216_at:552:117; Interrogation_Position=925; Antisense; AGCTTTGCAGATGTGATACTCCTCA
>probe:Drosophila_2:1633216_at:255:729; Interrogation_Position=952; Antisense; TTGGCAGTCCACGAAGCGGTCAGTA
>probe:Drosophila_2:1633216_at:359:93; Interrogation_Position=976; Antisense; AGTTCACGAATGATGCGACGCCTGA
>probe:Drosophila_2:1633216_at:418:409; Interrogation_Position=992; Antisense; GACGCCTGAGTCTGGAGAACTTTCC

Paste this into a BLAST search page for me
TTAAGCCGTCTGAACTTCTTCGAGTTCGAGTTTCGCGTTAGACCCTTGGGGAGGTCATCTTGCTGTTTCTGTCAAGTATGATCACCTACTTTACCTATGTTAGCCGCTCTTTATTCCGAGGTGAAGAGGTGAATAGCTTCGCCCGTATCGGAGCTACGTCGGCAATTGAGATCCTGAGATCCTTGGAACGTCCTGTCGGACGGAGGTCCTGTTGGTCGCAAGCAAATCCGGCCGGAGTTGTACGCAAGAAAGCTTTGCAGATGTGATACTCCTCATTGGCAGTCCACGAAGCGGTCAGTAAGTTCACGAATGATGCGACGCCTGAGACGCCTGAGTCTGGAGAACTTTCC

Full Affymetrix probeset data:

Annotations for 1633216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720