FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633217_at:

>probe:Drosophila_2:1633217_at:584:89; Interrogation_Position=1006; Antisense; AGTACCACGTCGAGGTGCCAATCTT
>probe:Drosophila_2:1633217_at:451:237; Interrogation_Position=1025; Antisense; AATCTTCAAGCACCACCAGGAGGAC
>probe:Drosophila_2:1633217_at:391:77; Interrogation_Position=1042; Antisense; AGGAGGACCATCACGACTACCACAG
>probe:Drosophila_2:1633217_at:218:259; Interrogation_Position=1068; Antisense; CACGGCCATGGACACTACTAGGGAT
>probe:Drosophila_2:1633217_at:668:147; Interrogation_Position=1084; Antisense; ACTAGGGATCGTCCGCTGATATCAA
>probe:Drosophila_2:1633217_at:370:115; Interrogation_Position=1173; Antisense; AGCAGGCGTGACACTGACAGCCAGT
>probe:Drosophila_2:1633217_at:111:597; Interrogation_Position=1203; Antisense; TGTGTCTCTCAGATGCATCCACGCA
>probe:Drosophila_2:1633217_at:651:605; Interrogation_Position=818; Antisense; TGAGGTGGAGAAACCCTACCCAGTC
>probe:Drosophila_2:1633217_at:579:307; Interrogation_Position=837; Antisense; CCAGTCCATGTGAAGGTGCCCGTGC
>probe:Drosophila_2:1633217_at:474:369; Interrogation_Position=884; Antisense; GAAGGTTCCTTATACCGTCGAGAAG
>probe:Drosophila_2:1633217_at:316:57; Interrogation_Position=919; Antisense; ATGAGGTCAAGGTGCCCATCGAGAA
>probe:Drosophila_2:1633217_at:110:665; Interrogation_Position=957; Antisense; TACACGGAGGTGAAGGTGCCCATCC
>probe:Drosophila_2:1633217_at:208:507; Interrogation_Position=972; Antisense; GTGCCCATCCACAAGGAGATTCCAG
>probe:Drosophila_2:1633217_at:356:699; Interrogation_Position=991; Antisense; TTCCAGTGCCGGAGAAGTACCACGT

Paste this into a BLAST search page for me
AGTACCACGTCGAGGTGCCAATCTTAATCTTCAAGCACCACCAGGAGGACAGGAGGACCATCACGACTACCACAGCACGGCCATGGACACTACTAGGGATACTAGGGATCGTCCGCTGATATCAAAGCAGGCGTGACACTGACAGCCAGTTGTGTCTCTCAGATGCATCCACGCATGAGGTGGAGAAACCCTACCCAGTCCCAGTCCATGTGAAGGTGCCCGTGCGAAGGTTCCTTATACCGTCGAGAAGATGAGGTCAAGGTGCCCATCGAGAATACACGGAGGTGAAGGTGCCCATCCGTGCCCATCCACAAGGAGATTCCAGTTCCAGTGCCGGAGAAGTACCACGT

Full Affymetrix probeset data:

Annotations for 1633217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720