Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633220_at:

>probe:Drosophila_2:1633220_at:640:639; Interrogation_Position=123; Antisense; TCTGTGTGGACAAGACCAGCTGCTT
>probe:Drosophila_2:1633220_at:387:117; Interrogation_Position=152; Antisense; AGCTATCAAAAGTATCCACCCACGC
>probe:Drosophila_2:1633220_at:58:561; Interrogation_Position=183; Antisense; GGAAGATTCACGATCGGACCACCGC
>probe:Drosophila_2:1633220_at:347:127; Interrogation_Position=200; Antisense; ACCACCGCGCGGGAAATGTACTATT
>probe:Drosophila_2:1633220_at:147:149; Interrogation_Position=219; Antisense; ACTATTGGCGCGACATCGAGGGCGT
>probe:Drosophila_2:1633220_at:463:77; Interrogation_Position=267; Antisense; AGGATCTGTACTTCACCAATTGGCC
>probe:Drosophila_2:1633220_at:240:153; Interrogation_Position=310; Antisense; ACAGGCCTGCTTGGGATTGCTCTAT
>probe:Drosophila_2:1633220_at:456:7; Interrogation_Position=325; Antisense; ATTGCTCTATGCCACGGGCAACAGA
>probe:Drosophila_2:1633220_at:199:527; Interrogation_Position=340; Antisense; GGGCAACAGATTCATCCGACTGACC
>probe:Drosophila_2:1633220_at:160:129; Interrogation_Position=373; Antisense; ACCAGCGGGCTTCAAGTGTGCACCA
>probe:Drosophila_2:1633220_at:283:581; Interrogation_Position=411; Antisense; TGGCCACCGCTCGAATTGTCAAAGT
>probe:Drosophila_2:1633220_at:679:393; Interrogation_Position=531; Antisense; GAAAGGGCGGTAATGGCGATCTTAA
>probe:Drosophila_2:1633220_at:63:151; Interrogation_Position=606; Antisense; ACATTATATTCAAATCCCGGTGTAT
>probe:Drosophila_2:1633220_at:81:713; Interrogation_Position=98; Antisense; TTCTATCCGAATGCAGATGTCTGGT

Paste this into a BLAST search page for me
TCTGTGTGGACAAGACCAGCTGCTTAGCTATCAAAAGTATCCACCCACGCGGAAGATTCACGATCGGACCACCGCACCACCGCGCGGGAAATGTACTATTACTATTGGCGCGACATCGAGGGCGTAGGATCTGTACTTCACCAATTGGCCACAGGCCTGCTTGGGATTGCTCTATATTGCTCTATGCCACGGGCAACAGAGGGCAACAGATTCATCCGACTGACCACCAGCGGGCTTCAAGTGTGCACCATGGCCACCGCTCGAATTGTCAAAGTGAAAGGGCGGTAATGGCGATCTTAAACATTATATTCAAATCCCGGTGTATTTCTATCCGAATGCAGATGTCTGGT

Full Affymetrix probeset data:

Annotations for 1633220_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime