Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633222_at:

>probe:Drosophila_2:1633222_at:580:425; Interrogation_Position=1000; Antisense; GAGATCCTGCGGGAGTACCACAAGT
>probe:Drosophila_2:1633222_at:298:225; Interrogation_Position=1042; Antisense; AAGGACAGCGACTGTCTGCTGGCCT
>probe:Drosophila_2:1633222_at:329:317; Interrogation_Position=1063; Antisense; GCCTGCGAGAACGTGGTGGACATTC
>probe:Drosophila_2:1633222_at:142:373; Interrogation_Position=1102; Antisense; GAAGAGATTGGCCTGGACAACTATA
>probe:Drosophila_2:1633222_at:530:175; Interrogation_Position=1127; Antisense; AAACCGAAGTGGAAGTGCCTGCAGA
>probe:Drosophila_2:1633222_at:195:321; Interrogation_Position=1180; Antisense; GCCGCCTATGTGAAGAGTTTGCTTG
>probe:Drosophila_2:1633222_at:707:485; Interrogation_Position=1216; Antisense; GTAGCAACCTGGACCGTTTGTAAAT
>probe:Drosophila_2:1633222_at:231:489; Interrogation_Position=1365; Antisense; GTACGCACACATTCAATTGCAGGGT
>probe:Drosophila_2:1633222_at:558:601; Interrogation_Position=1422; Antisense; TGATTAGTTCAAGTAGCGTCGTTAT
>probe:Drosophila_2:1633222_at:105:487; Interrogation_Position=1434; Antisense; GTAGCGTCGTTATCTAGTTTATCTA
>probe:Drosophila_2:1633222_at:488:245; Interrogation_Position=1458; Antisense; AATTATCGTTAATCCATCGCTCTGC
>probe:Drosophila_2:1633222_at:512:281; Interrogation_Position=1477; Antisense; CTCTGCCGCCTCAATTGTATATGTA
>probe:Drosophila_2:1633222_at:440:167; Interrogation_Position=1540; Antisense; AAATGTTTGGCATTCGCCTTGCCAT
>probe:Drosophila_2:1633222_at:110:275; Interrogation_Position=1550; Antisense; CATTCGCCTTGCCATGAAACGTTTA

Paste this into a BLAST search page for me
GAGATCCTGCGGGAGTACCACAAGTAAGGACAGCGACTGTCTGCTGGCCTGCCTGCGAGAACGTGGTGGACATTCGAAGAGATTGGCCTGGACAACTATAAAACCGAAGTGGAAGTGCCTGCAGAGCCGCCTATGTGAAGAGTTTGCTTGGTAGCAACCTGGACCGTTTGTAAATGTACGCACACATTCAATTGCAGGGTTGATTAGTTCAAGTAGCGTCGTTATGTAGCGTCGTTATCTAGTTTATCTAAATTATCGTTAATCCATCGCTCTGCCTCTGCCGCCTCAATTGTATATGTAAAATGTTTGGCATTCGCCTTGCCATCATTCGCCTTGCCATGAAACGTTTA

Full Affymetrix probeset data:

Annotations for 1633222_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime