FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633224_at:

>probe:Drosophila_2:1633224_at:199:77; Interrogation_Position=1045; Antisense; AGGAGTGCCCAGAAGACGCGGTTTC
>probe:Drosophila_2:1633224_at:116:411; Interrogation_Position=1059; Antisense; GACGCGGTTTCCCAAGACAGTGAGT
>probe:Drosophila_2:1633224_at:140:153; Interrogation_Position=1075; Antisense; ACAGTGAGTGTTCGATTGGTGCCCC
>probe:Drosophila_2:1633224_at:294:319; Interrogation_Position=1095; Antisense; GCCCCGGGATCAGTGTCTCAAGGAG
>probe:Drosophila_2:1633224_at:304:207; Interrogation_Position=1123; Antisense; AAGCGGGCGGAGGACTTCATCACGC
>probe:Drosophila_2:1633224_at:436:13; Interrogation_Position=1169; Antisense; ATTCAGAATCACATGGTCCCTGCTT
>probe:Drosophila_2:1633224_at:710:551; Interrogation_Position=1195; Antisense; GGAGACTCGGGATCTGCTCTGATCG
>probe:Drosophila_2:1633224_at:562:619; Interrogation_Position=1209; Antisense; TGCTCTGATCGTCCTGCGTAACAAT
>probe:Drosophila_2:1633224_at:200:139; Interrogation_Position=1241; Antisense; ACGTTCGTGGTGTGGTCTCTTTATC
>probe:Drosophila_2:1633224_at:118:313; Interrogation_Position=1271; Antisense; GCCACGGAGAGATTTGCGACCTTAG
>probe:Drosophila_2:1633224_at:224:469; Interrogation_Position=1318; Antisense; GTTGCACGGCACATTGACTGGGTAC
>probe:Drosophila_2:1633224_at:235:83; Interrogation_Position=887; Antisense; AGGGCAATCCAGTTCCGGATGCGGA
>probe:Drosophila_2:1633224_at:648:609; Interrogation_Position=929; Antisense; TGACCTCTCCGATGGTGTACACCAA
>probe:Drosophila_2:1633224_at:162:525; Interrogation_Position=978; Antisense; GGGCTCCAATATGGGATTGCCACCG

Paste this into a BLAST search page for me
AGGAGTGCCCAGAAGACGCGGTTTCGACGCGGTTTCCCAAGACAGTGAGTACAGTGAGTGTTCGATTGGTGCCCCGCCCCGGGATCAGTGTCTCAAGGAGAAGCGGGCGGAGGACTTCATCACGCATTCAGAATCACATGGTCCCTGCTTGGAGACTCGGGATCTGCTCTGATCGTGCTCTGATCGTCCTGCGTAACAATACGTTCGTGGTGTGGTCTCTTTATCGCCACGGAGAGATTTGCGACCTTAGGTTGCACGGCACATTGACTGGGTACAGGGCAATCCAGTTCCGGATGCGGATGACCTCTCCGATGGTGTACACCAAGGGCTCCAATATGGGATTGCCACCG

Full Affymetrix probeset data:

Annotations for 1633224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720