FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633225_at:

>probe:Drosophila_2:1633225_at:149:161; Interrogation_Position=283; Antisense; AAATTGGACGCCAGCCTGAAGACTC
>probe:Drosophila_2:1633225_at:593:595; Interrogation_Position=345; Antisense; TGTGGCACCCATCAAGAGCTACAAG
>probe:Drosophila_2:1633225_at:213:217; Interrogation_Position=418; Antisense; AAGTTCTAAGCAACTCCGCCGGAGA
>probe:Drosophila_2:1633225_at:289:317; Interrogation_Position=435; Antisense; GCCGGAGACCATGTTTCACGTATAG
>probe:Drosophila_2:1633225_at:702:485; Interrogation_Position=485; Antisense; GTAGTTAGTCCCCATTGATTGTTAA
>probe:Drosophila_2:1633225_at:560:671; Interrogation_Position=555; Antisense; TATACGTTAGCTATTCCGACAGTGA
>probe:Drosophila_2:1633225_at:725:83; Interrogation_Position=575; Antisense; AGTGATGGGAAGTCCTCAGCCAGGT
>probe:Drosophila_2:1633225_at:237:647; Interrogation_Position=590; Antisense; TCAGCCAGGTGGAGACTACGTAGCC
>probe:Drosophila_2:1633225_at:143:675; Interrogation_Position=610; Antisense; TAGCCAAATACCTCTTGACCTCTTT
>probe:Drosophila_2:1633225_at:294:19; Interrogation_Position=732; Antisense; ATATTGTGCAACTCTTACCATACGA
>probe:Drosophila_2:1633225_at:183:293; Interrogation_Position=754; Antisense; CGAGTGCGCTTTATCTTACGTAATT
>probe:Drosophila_2:1633225_at:603:475; Interrogation_Position=787; Antisense; GTTATATGTTGAATCCTTCCTAGGA
>probe:Drosophila_2:1633225_at:634:679; Interrogation_Position=807; Antisense; TAGGAATGGGTGACTCCCCATCACT
>probe:Drosophila_2:1633225_at:193:35; Interrogation_Position=826; Antisense; ATCACTGTGCTATGGCAGCCTAGAC

Paste this into a BLAST search page for me
AAATTGGACGCCAGCCTGAAGACTCTGTGGCACCCATCAAGAGCTACAAGAAGTTCTAAGCAACTCCGCCGGAGAGCCGGAGACCATGTTTCACGTATAGGTAGTTAGTCCCCATTGATTGTTAATATACGTTAGCTATTCCGACAGTGAAGTGATGGGAAGTCCTCAGCCAGGTTCAGCCAGGTGGAGACTACGTAGCCTAGCCAAATACCTCTTGACCTCTTTATATTGTGCAACTCTTACCATACGACGAGTGCGCTTTATCTTACGTAATTGTTATATGTTGAATCCTTCCTAGGATAGGAATGGGTGACTCCCCATCACTATCACTGTGCTATGGCAGCCTAGAC

Full Affymetrix probeset data:

Annotations for 1633225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720