FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633232_at:

>probe:Drosophila_2:1633232_at:369:619; Interrogation_Position=1014; Antisense; TGCATTCAAATGGTGTGGAGCTGTT
>probe:Drosophila_2:1633232_at:149:15; Interrogation_Position=1073; Antisense; ATTACATTTCTCTTTTGCTATCTCA
>probe:Drosophila_2:1633232_at:148:693; Interrogation_Position=1086; Antisense; TTTGCTATCTCACTCACTCACACGA
>probe:Drosophila_2:1633232_at:396:361; Interrogation_Position=656; Antisense; GCAATTGCAAAGCTCCCATTACGGA
>probe:Drosophila_2:1633232_at:585:105; Interrogation_Position=680; Antisense; AGAACGCGATCGTGGCCCTCGACGC
>probe:Drosophila_2:1633232_at:720:133; Interrogation_Position=701; Antisense; ACGCCAAGTGGCATCGGGAGTGCTT
>probe:Drosophila_2:1633232_at:323:395; Interrogation_Position=735; Antisense; GAAATGCAAAACACCCATCACGGCC
>probe:Drosophila_2:1633232_at:500:139; Interrogation_Position=754; Antisense; ACGGCCAGTTCCTTTGTCGTGGAGG
>probe:Drosophila_2:1633232_at:263:501; Interrogation_Position=769; Antisense; GTCGTGGAGGATAACCAACCGTTGT
>probe:Drosophila_2:1633232_at:285:653; Interrogation_Position=780; Antisense; TAACCAACCGTTGTGCAAGGCCTGC
>probe:Drosophila_2:1633232_at:656:359; Interrogation_Position=794; Antisense; GCAAGGCCTGCTCCGATTAAAGAAT
>probe:Drosophila_2:1633232_at:383:365; Interrogation_Position=815; Antisense; GAATCCGGAACGCAACCATTTCACA
>probe:Drosophila_2:1633232_at:713:129; Interrogation_Position=829; Antisense; ACCATTTCACATCGCTATCCATGTA
>probe:Drosophila_2:1633232_at:204:309; Interrogation_Position=885; Antisense; CCAATTTGTTGATCCAATCGCCGGG

Paste this into a BLAST search page for me
TGCATTCAAATGGTGTGGAGCTGTTATTACATTTCTCTTTTGCTATCTCATTTGCTATCTCACTCACTCACACGAGCAATTGCAAAGCTCCCATTACGGAAGAACGCGATCGTGGCCCTCGACGCACGCCAAGTGGCATCGGGAGTGCTTGAAATGCAAAACACCCATCACGGCCACGGCCAGTTCCTTTGTCGTGGAGGGTCGTGGAGGATAACCAACCGTTGTTAACCAACCGTTGTGCAAGGCCTGCGCAAGGCCTGCTCCGATTAAAGAATGAATCCGGAACGCAACCATTTCACAACCATTTCACATCGCTATCCATGTACCAATTTGTTGATCCAATCGCCGGG

Full Affymetrix probeset data:

Annotations for 1633232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720