Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633234_at:

>probe:Drosophila_2:1633234_at:45:85; Interrogation_Position=3591; Antisense; AGTCTTGTCGACCTTTTACCGTGCT
>probe:Drosophila_2:1633234_at:402:621; Interrogation_Position=3612; Antisense; TGCTCCCTGCTCTGATGAACGAGTA
>probe:Drosophila_2:1633234_at:634:611; Interrogation_Position=3627; Antisense; TGAACGAGTACCGAGTGCCCGAGCT
>probe:Drosophila_2:1633234_at:299:321; Interrogation_Position=3643; Antisense; GCCCGAGCTCAACGTTCAGAATGGT
>probe:Drosophila_2:1633234_at:531:89; Interrogation_Position=3675; Antisense; AGTCACTCTCTTTCCTGTTTGAATA
>probe:Drosophila_2:1633234_at:209:543; Interrogation_Position=3718; Antisense; GGATTACATATACGCCGTCTGTCCA
>probe:Drosophila_2:1633234_at:611:447; Interrogation_Position=3752; Antisense; GATGCCCTCATGGACCGAGATCTAG
>probe:Drosophila_2:1633234_at:119:641; Interrogation_Position=3834; Antisense; TCGGCTGCGAGGATGCTTTGACCCA
>probe:Drosophila_2:1633234_at:54:37; Interrogation_Position=3858; Antisense; ATCTTCTCAACTACGTGTGGCCCAA
>probe:Drosophila_2:1633234_at:558:581; Interrogation_Position=3875; Antisense; TGGCCCAACATTTTTGAGACGTCCC
>probe:Drosophila_2:1633234_at:638:615; Interrogation_Position=3909; Antisense; TGCAAGCCTTCATGGATTCCGTGGA
>probe:Drosophila_2:1633234_at:617:555; Interrogation_Position=3953; Antisense; GGACCCATTAAGATCCTGCAATATA
>probe:Drosophila_2:1633234_at:26:17; Interrogation_Position=3973; Antisense; ATATACGCTACAGGGACTTTTCCAC
>probe:Drosophila_2:1633234_at:217:59; Interrogation_Position=4095; Antisense; ATGATCCCAAGAACCAGTACGAGCG

Paste this into a BLAST search page for me
AGTCTTGTCGACCTTTTACCGTGCTTGCTCCCTGCTCTGATGAACGAGTATGAACGAGTACCGAGTGCCCGAGCTGCCCGAGCTCAACGTTCAGAATGGTAGTCACTCTCTTTCCTGTTTGAATAGGATTACATATACGCCGTCTGTCCAGATGCCCTCATGGACCGAGATCTAGTCGGCTGCGAGGATGCTTTGACCCAATCTTCTCAACTACGTGTGGCCCAATGGCCCAACATTTTTGAGACGTCCCTGCAAGCCTTCATGGATTCCGTGGAGGACCCATTAAGATCCTGCAATATAATATACGCTACAGGGACTTTTCCACATGATCCCAAGAACCAGTACGAGCG

Full Affymetrix probeset data:

Annotations for 1633234_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime