FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633237_at:

>probe:Drosophila_2:1633237_at:572:153; Interrogation_Position=1010; Antisense; ACATGTGGAGTTGCACCCGGCGGAA
>probe:Drosophila_2:1633237_at:426:47; Interrogation_Position=1040; Antisense; ATCCAGAGTGCTGAGGGCTTACTAA
>probe:Drosophila_2:1633237_at:238:659; Interrogation_Position=1062; Antisense; TAAGTTGGCCAGAGATTTGCTCGAA
>probe:Drosophila_2:1633237_at:255:375; Interrogation_Position=1084; Antisense; GAAGTTGTCGCAGAACGCATCCGCT
>probe:Drosophila_2:1633237_at:18:339; Interrogation_Position=1175; Antisense; GCTCTCCGGCCAGCAGATGATAATG
>probe:Drosophila_2:1633237_at:79:17; Interrogation_Position=1203; Antisense; ATTTTGGCGTATGGCTGAGCTTCGA
>probe:Drosophila_2:1633237_at:443:609; Interrogation_Position=1218; Antisense; TGAGCTTCGATGATCCGGATTTTGC
>probe:Drosophila_2:1633237_at:427:251; Interrogation_Position=1264; Antisense; CAAGGGCAAAGGACTCGGCGGAATT
>probe:Drosophila_2:1633237_at:193:331; Interrogation_Position=1281; Antisense; GCGGAATTGCCCTTTTCGATTTAAG
>probe:Drosophila_2:1633237_at:685:53; Interrogation_Position=1311; Antisense; ATGACTTCCGTGGACTTTGCACTGG
>probe:Drosophila_2:1633237_at:201:691; Interrogation_Position=1326; Antisense; TTTGCACTGGCCAAAAGTACCCCAT
>probe:Drosophila_2:1633237_at:491:89; Interrogation_Position=1341; Antisense; AGTACCCCATACTGCGGTCAATTAA
>probe:Drosophila_2:1633237_at:384:545; Interrogation_Position=974; Antisense; GGATCTGGACTCAGTGGTGCTCCCA
>probe:Drosophila_2:1633237_at:494:535; Interrogation_Position=989; Antisense; GGTGCTCCCATTGTTCATGAGACAT

Paste this into a BLAST search page for me
ACATGTGGAGTTGCACCCGGCGGAAATCCAGAGTGCTGAGGGCTTACTAATAAGTTGGCCAGAGATTTGCTCGAAGAAGTTGTCGCAGAACGCATCCGCTGCTCTCCGGCCAGCAGATGATAATGATTTTGGCGTATGGCTGAGCTTCGATGAGCTTCGATGATCCGGATTTTGCCAAGGGCAAAGGACTCGGCGGAATTGCGGAATTGCCCTTTTCGATTTAAGATGACTTCCGTGGACTTTGCACTGGTTTGCACTGGCCAAAAGTACCCCATAGTACCCCATACTGCGGTCAATTAAGGATCTGGACTCAGTGGTGCTCCCAGGTGCTCCCATTGTTCATGAGACAT

Full Affymetrix probeset data:

Annotations for 1633237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720