FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633239_at:

>probe:Drosophila_2:1633239_at:471:231; Interrogation_Position=1101; Antisense; AATGATATCAAGGTGAGCTACGGCT
>probe:Drosophila_2:1633239_at:77:21; Interrogation_Position=1105; Antisense; ATATCAAGGTGAGCTACGGCTGGTG
>probe:Drosophila_2:1633239_at:62:609; Interrogation_Position=1114; Antisense; TGAGCTACGGCTGGTGGGTTACATA
>probe:Drosophila_2:1633239_at:433:339; Interrogation_Position=1117; Antisense; GCTACGGCTGGTGGGTTACATATTC
>probe:Drosophila_2:1633239_at:7:671; Interrogation_Position=1119; Antisense; TACGGCTGGTGGGTTACATATTCCA
>probe:Drosophila_2:1633239_at:87:531; Interrogation_Position=1129; Antisense; GGGTTACATATTCCACCTATGCCAG
>probe:Drosophila_2:1633239_at:414:475; Interrogation_Position=1131; Antisense; GTTACATATTCCACCTATGCCAGGT
>probe:Drosophila_2:1633239_at:375:151; Interrogation_Position=1134; Antisense; ACATATTCCACCTATGCCAGGTAAA
>probe:Drosophila_2:1633239_at:109:719; Interrogation_Position=1139; Antisense; TTCCACCTATGCCAGGTAAAAGCGA
>probe:Drosophila_2:1633239_at:502:1; Interrogation_Position=1147; Antisense; ATGCCAGGTAAAAGCGAAACCAGCT
>probe:Drosophila_2:1633239_at:461:265; Interrogation_Position=1151; Antisense; CAGGTAAAAGCGAAACCAGCTAGTT
>probe:Drosophila_2:1633239_at:432:659; Interrogation_Position=1185; Antisense; TAACCACATTAATTATAGCGCCTGC
>probe:Drosophila_2:1633239_at:395:309; Interrogation_Position=1188; Antisense; CCACATTAATTATAGCGCCTGCGCA
>probe:Drosophila_2:1633239_at:424:151; Interrogation_Position=1190; Antisense; ACATTAATTATAGCGCCTGCGCAAG

Paste this into a BLAST search page for me
AATGATATCAAGGTGAGCTACGGCTATATCAAGGTGAGCTACGGCTGGTGTGAGCTACGGCTGGTGGGTTACATAGCTACGGCTGGTGGGTTACATATTCTACGGCTGGTGGGTTACATATTCCAGGGTTACATATTCCACCTATGCCAGGTTACATATTCCACCTATGCCAGGTACATATTCCACCTATGCCAGGTAAATTCCACCTATGCCAGGTAAAAGCGAATGCCAGGTAAAAGCGAAACCAGCTCAGGTAAAAGCGAAACCAGCTAGTTTAACCACATTAATTATAGCGCCTGCCCACATTAATTATAGCGCCTGCGCAACATTAATTATAGCGCCTGCGCAAG

Full Affymetrix probeset data:

Annotations for 1633239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720