FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633243_at:

>probe:Drosophila_2:1633243_at:99:559; Interrogation_Position=2710; Antisense; GGACACAAACTGCTTTTTAACCATT
>probe:Drosophila_2:1633243_at:573:429; Interrogation_Position=2805; Antisense; GAGTATATAATACGCTTTCCCACGA
>probe:Drosophila_2:1633243_at:237:275; Interrogation_Position=2819; Antisense; CTTTCCCACGATGCACTTAGTATTA
>probe:Drosophila_2:1633243_at:47:25; Interrogation_Position=2850; Antisense; ATATGTATGGTCATCCTGCTTTGTC
>probe:Drosophila_2:1633243_at:257:661; Interrogation_Position=2885; Antisense; TAACGAACCATATCCGGATCCACTT
>probe:Drosophila_2:1633243_at:127:529; Interrogation_Position=2913; Antisense; GGGTCCCCTAGTATTACTACTGTTG
>probe:Drosophila_2:1633243_at:192:7; Interrogation_Position=3021; Antisense; ATTGTTGACTCATTTAGGCGCCTTG
>probe:Drosophila_2:1633243_at:278:461; Interrogation_Position=3095; Antisense; GATTAATCGTCTACCAAAATGGGCT
>probe:Drosophila_2:1633243_at:272:185; Interrogation_Position=3110; Antisense; AAAATGGGCTTACGCCGCATCAGAT
>probe:Drosophila_2:1633243_at:729:33; Interrogation_Position=3128; Antisense; ATCAGATATTTTTTGGCGGCGTAGC
>probe:Drosophila_2:1633243_at:459:487; Interrogation_Position=3148; Antisense; GTAGCCTGAACTACGCTTTTCGGCT
>probe:Drosophila_2:1633243_at:412:699; Interrogation_Position=3164; Antisense; TTTTCGGCTTCGCATAACATATCAG
>probe:Drosophila_2:1633243_at:186:203; Interrogation_Position=3229; Antisense; AACCAATGCTGAACTGTACCGTGAC
>probe:Drosophila_2:1633243_at:68:489; Interrogation_Position=3244; Antisense; GTACCGTGACTAAACCATAAGCTTA

Paste this into a BLAST search page for me
GGACACAAACTGCTTTTTAACCATTGAGTATATAATACGCTTTCCCACGACTTTCCCACGATGCACTTAGTATTAATATGTATGGTCATCCTGCTTTGTCTAACGAACCATATCCGGATCCACTTGGGTCCCCTAGTATTACTACTGTTGATTGTTGACTCATTTAGGCGCCTTGGATTAATCGTCTACCAAAATGGGCTAAAATGGGCTTACGCCGCATCAGATATCAGATATTTTTTGGCGGCGTAGCGTAGCCTGAACTACGCTTTTCGGCTTTTTCGGCTTCGCATAACATATCAGAACCAATGCTGAACTGTACCGTGACGTACCGTGACTAAACCATAAGCTTA

Full Affymetrix probeset data:

Annotations for 1633243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720