FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633244_at:

>probe:Drosophila_2:1633244_at:170:471; Interrogation_Position=3625; Antisense; GTTCTGCGAATGTCCAAGTATCTCA
>probe:Drosophila_2:1633244_at:290:27; Interrogation_Position=3749; Antisense; ATAGCACTATGCTATTTCCCAGGCC
>probe:Drosophila_2:1633244_at:310:711; Interrogation_Position=3764; Antisense; TTCCCAGGCCAATCTTTAAGACTCT
>probe:Drosophila_2:1633244_at:544:539; Interrogation_Position=3801; Antisense; GGTTACATCCAACGAGTCCATTTCT
>probe:Drosophila_2:1633244_at:126:713; Interrogation_Position=3822; Antisense; TTCTCCTGACCTCGCGTACAAAATT
>probe:Drosophila_2:1633244_at:350:227; Interrogation_Position=3868; Antisense; AAGGCTCACCTCAAGAAGATTTCTA
>probe:Drosophila_2:1633244_at:91:677; Interrogation_Position=3891; Antisense; TAGACGCGCTTTTGCACAACGAGGT
>probe:Drosophila_2:1633244_at:281:489; Interrogation_Position=3942; Antisense; GTACTTGATGGACCAGCAGCGTCAA
>probe:Drosophila_2:1633244_at:80:171; Interrogation_Position=3971; Antisense; AAAGTCGCCAACTGTCCGAGGTATG
>probe:Drosophila_2:1633244_at:502:79; Interrogation_Position=3989; Antisense; AGGTATGTCGCAATTCCGAGGAGCA
>probe:Drosophila_2:1633244_at:303:115; Interrogation_Position=4045; Antisense; AGCAGTGACTCCTTGCGAGGGATCA
>probe:Drosophila_2:1633244_at:459:545; Interrogation_Position=4064; Antisense; GGATCAGGGATCTCTTTCGCGATCA
>probe:Drosophila_2:1633244_at:409:5; Interrogation_Position=4088; Antisense; ATTGCGACCTGCGAGACCCATTGTT
>probe:Drosophila_2:1633244_at:255:173; Interrogation_Position=4127; Antisense; AAAGCATCGAGCGTCTCTACAGGGA

Paste this into a BLAST search page for me
GTTCTGCGAATGTCCAAGTATCTCAATAGCACTATGCTATTTCCCAGGCCTTCCCAGGCCAATCTTTAAGACTCTGGTTACATCCAACGAGTCCATTTCTTTCTCCTGACCTCGCGTACAAAATTAAGGCTCACCTCAAGAAGATTTCTATAGACGCGCTTTTGCACAACGAGGTGTACTTGATGGACCAGCAGCGTCAAAAAGTCGCCAACTGTCCGAGGTATGAGGTATGTCGCAATTCCGAGGAGCAAGCAGTGACTCCTTGCGAGGGATCAGGATCAGGGATCTCTTTCGCGATCAATTGCGACCTGCGAGACCCATTGTTAAAGCATCGAGCGTCTCTACAGGGA

Full Affymetrix probeset data:

Annotations for 1633244_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720