FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633245_at:

>probe:Drosophila_2:1633245_at:109:421; Interrogation_Position=396; Antisense; GAGCAGTACTACTTCACAGTGGATC
>probe:Drosophila_2:1633245_at:617:257; Interrogation_Position=410; Antisense; CACAGTGGATCGTCCTACGGCGGAG
>probe:Drosophila_2:1633245_at:325:589; Interrogation_Position=469; Antisense; TGGTTCGACCTTTCAAGGCAGCCGA
>probe:Drosophila_2:1633245_at:653:267; Interrogation_Position=495; Antisense; CAGTGGATCCGTTACATAGTGAGCA
>probe:Drosophila_2:1633245_at:362:595; Interrogation_Position=522; Antisense; TGGGCGGCGGATCAGTACTATCACC
>probe:Drosophila_2:1633245_at:502:423; Interrogation_Position=569; Antisense; GAGACAACGCTATGCCATTGGTCAG
>probe:Drosophila_2:1633245_at:443:373; Interrogation_Position=596; Antisense; GAAGTCTCAGGAGCGCTGCTTCGGA
>probe:Drosophila_2:1633245_at:724:587; Interrogation_Position=637; Antisense; TGGAGTTCTACACGGAGCATCCACT
>probe:Drosophila_2:1633245_at:307:223; Interrogation_Position=675; Antisense; AAGGTCCGGAGCCAGTGCGTCCAAC
>probe:Drosophila_2:1633245_at:349:503; Interrogation_Position=703; Antisense; GTCCCATCAGTTACGCTTAGCTAGG
>probe:Drosophila_2:1633245_at:239:709; Interrogation_Position=811; Antisense; TTGAAGGCGCACTGGTTGTTCTGCA
>probe:Drosophila_2:1633245_at:656:723; Interrogation_Position=826; Antisense; TTGTTCTGCATCAGGGCGGGCCAGA
>probe:Drosophila_2:1633245_at:632:369; Interrogation_Position=852; Antisense; GAAGGCTTTTATCAGATCCGATCGC
>probe:Drosophila_2:1633245_at:237:559; Interrogation_Position=917; Antisense; GGAAACCTGCATGGGATTTACGTAG

Paste this into a BLAST search page for me
GAGCAGTACTACTTCACAGTGGATCCACAGTGGATCGTCCTACGGCGGAGTGGTTCGACCTTTCAAGGCAGCCGACAGTGGATCCGTTACATAGTGAGCATGGGCGGCGGATCAGTACTATCACCGAGACAACGCTATGCCATTGGTCAGGAAGTCTCAGGAGCGCTGCTTCGGATGGAGTTCTACACGGAGCATCCACTAAGGTCCGGAGCCAGTGCGTCCAACGTCCCATCAGTTACGCTTAGCTAGGTTGAAGGCGCACTGGTTGTTCTGCATTGTTCTGCATCAGGGCGGGCCAGAGAAGGCTTTTATCAGATCCGATCGCGGAAACCTGCATGGGATTTACGTAG

Full Affymetrix probeset data:

Annotations for 1633245_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720