FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633247_at:

>probe:Drosophila_2:1633247_at:266:311; Interrogation_Position=120; Antisense; GCCAAGATCTTGTTCGAGCACCTGT
>probe:Drosophila_2:1633247_at:426:377; Interrogation_Position=167; Antisense; GAAGCATTTGATTGACCGGCCAGAT
>probe:Drosophila_2:1633247_at:624:561; Interrogation_Position=192; Antisense; GGAACATATTGCTTTCGGGAGCACA
>probe:Drosophila_2:1633247_at:698:527; Interrogation_Position=208; Antisense; GGGAGCACAAGGATCGGGTCTACTA
>probe:Drosophila_2:1633247_at:325:531; Interrogation_Position=223; Antisense; GGGTCTACTACGTCTCGGAGCGGAT
>probe:Drosophila_2:1633247_at:54:121; Interrogation_Position=253; Antisense; AGCTGAGCGAGTGCTTCGGCTACAA
>probe:Drosophila_2:1633247_at:203:131; Interrogation_Position=297; Antisense; ACCTGCTTCGGCAAGTTCTCCAAGA
>probe:Drosophila_2:1633247_at:75:161; Interrogation_Position=328; Antisense; AACTGAAGTTCCATATCACGGCCCT
>probe:Drosophila_2:1633247_at:285:159; Interrogation_Position=379; Antisense; ACAAGGTGTGGGTGAAGCCCTCCTT
>probe:Drosophila_2:1633247_at:423:637; Interrogation_Position=403; Antisense; TCGAGCAGCAGTTTCTCTACGGCAA
>probe:Drosophila_2:1633247_at:669:405; Interrogation_Position=445; Antisense; GACTGGGTCGCATCACGGAGAACGC
>probe:Drosophila_2:1633247_at:210:83; Interrogation_Position=481; Antisense; AGGGCGTGGTGGTCTACTCCATGAA
>probe:Drosophila_2:1633247_at:166:57; Interrogation_Position=570; Antisense; ATGACCACCGTATGCTTTCATCAGT
>probe:Drosophila_2:1633247_at:674:437; Interrogation_Position=621; Antisense; GAGGACACGCTCTTTTAGATCCATA

Paste this into a BLAST search page for me
GCCAAGATCTTGTTCGAGCACCTGTGAAGCATTTGATTGACCGGCCAGATGGAACATATTGCTTTCGGGAGCACAGGGAGCACAAGGATCGGGTCTACTAGGGTCTACTACGTCTCGGAGCGGATAGCTGAGCGAGTGCTTCGGCTACAAACCTGCTTCGGCAAGTTCTCCAAGAAACTGAAGTTCCATATCACGGCCCTACAAGGTGTGGGTGAAGCCCTCCTTTCGAGCAGCAGTTTCTCTACGGCAAGACTGGGTCGCATCACGGAGAACGCAGGGCGTGGTGGTCTACTCCATGAAATGACCACCGTATGCTTTCATCAGTGAGGACACGCTCTTTTAGATCCATA

Full Affymetrix probeset data:

Annotations for 1633247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720