FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633249_at:

>probe:Drosophila_2:1633249_at:119:27; Interrogation_Position=4069; Antisense; ATAGCCGTACTCCAGCAATGCGCTA
>probe:Drosophila_2:1633249_at:578:233; Interrogation_Position=4085; Antisense; AATGCGCTAAGTCCGAGTGCCAAAC
>probe:Drosophila_2:1633249_at:630:177; Interrogation_Position=4106; Antisense; AAACGGCACCGATTCAGTACCTGGC
>probe:Drosophila_2:1633249_at:648:89; Interrogation_Position=4121; Antisense; AGTACCTGGCAAGCGTGCGCAATCA
>probe:Drosophila_2:1633249_at:676:617; Interrogation_Position=4148; Antisense; TGCAGCTTTCCATGCGGCAGTATGT
>probe:Drosophila_2:1633249_at:478:287; Interrogation_Position=4162; Antisense; CGGCAGTATGTGCAACGGTTCTATA
>probe:Drosophila_2:1633249_at:345:185; Interrogation_Position=4187; Antisense; AAAATTGGCTGGTCTGCGATCACCC
>probe:Drosophila_2:1633249_at:89:455; Interrogation_Position=4204; Antisense; GATCACCCGGATTGCAACTTCAACA
>probe:Drosophila_2:1633249_at:580:353; Interrogation_Position=4289; Antisense; GCAGCCTGCTGCGTCAGTATACGGA
>probe:Drosophila_2:1633249_at:397:29; Interrogation_Position=4307; Antisense; ATACGGAGCGGGACCTGTACAATCA
>probe:Drosophila_2:1633249_at:507:491; Interrogation_Position=4323; Antisense; GTACAATCAGCTGTGCTACCTGCGA
>probe:Drosophila_2:1633249_at:649:11; Interrogation_Position=4347; Antisense; ATTCATGTTCGACCTCGGCAAGCAA
>probe:Drosophila_2:1633249_at:708:669; Interrogation_Position=4465; Antisense; TACGTGATCATCTCGCTAAGCAAGC
>probe:Drosophila_2:1633249_at:656:575; Interrogation_Position=4533; Antisense; GGCGCAGCCCCAGATCGAAGCAATT

Paste this into a BLAST search page for me
ATAGCCGTACTCCAGCAATGCGCTAAATGCGCTAAGTCCGAGTGCCAAACAAACGGCACCGATTCAGTACCTGGCAGTACCTGGCAAGCGTGCGCAATCATGCAGCTTTCCATGCGGCAGTATGTCGGCAGTATGTGCAACGGTTCTATAAAAATTGGCTGGTCTGCGATCACCCGATCACCCGGATTGCAACTTCAACAGCAGCCTGCTGCGTCAGTATACGGAATACGGAGCGGGACCTGTACAATCAGTACAATCAGCTGTGCTACCTGCGAATTCATGTTCGACCTCGGCAAGCAATACGTGATCATCTCGCTAAGCAAGCGGCGCAGCCCCAGATCGAAGCAATT

Full Affymetrix probeset data:

Annotations for 1633249_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720