FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633251_at:

>probe:Drosophila_2:1633251_at:33:133; Interrogation_Position=112; Antisense; ACCGTCGGCGACTGCAACATCGAGG
>probe:Drosophila_2:1633251_at:43:359; Interrogation_Position=125; Antisense; GCAACATCGAGGAGCCGGAAGATGA
>probe:Drosophila_2:1633251_at:536:47; Interrogation_Position=13; Antisense; ATGCCCACCTTTGAGGAGATCGTCG
>probe:Drosophila_2:1633251_at:682:109; Interrogation_Position=155; Antisense; AGAAGGCCCGCTACAACGCCTGGAA
>probe:Drosophila_2:1633251_at:565:309; Interrogation_Position=17; Antisense; CCACCTTTGAGGAGATCGTCGAGAA
>probe:Drosophila_2:1633251_at:608:287; Interrogation_Position=174; Antisense; CTGGAAGAGCAAGGCCGGTCTGACC
>probe:Drosophila_2:1633251_at:276:535; Interrogation_Position=190; Antisense; GGTCTGACCGCCGATGATGCCAAGG
>probe:Drosophila_2:1633251_at:272:49; Interrogation_Position=206; Antisense; ATGCCAAGGCCTACTACATCGAGGT
>probe:Drosophila_2:1633251_at:304:251; Interrogation_Position=210; Antisense; CAAGGCCTACTACATCGAGGTCTAC
>probe:Drosophila_2:1633251_at:674:77; Interrogation_Position=227; Antisense; AGGTCTACAAGAAGTACGCTCCCCA
>probe:Drosophila_2:1633251_at:450:209; Interrogation_Position=235; Antisense; AAGAAGTACGCTCCCCAGTACGAAT
>probe:Drosophila_2:1633251_at:615:147; Interrogation_Position=50; Antisense; ACTTCAAGAACCTGCCTAGCAAGGA
>probe:Drosophila_2:1633251_at:483:129; Interrogation_Position=59; Antisense; ACCTGCCTAGCAAGGAGGAGTTCCT
>probe:Drosophila_2:1633251_at:281:429; Interrogation_Position=85; Antisense; GAGTTCTACGGCTACTACAAGCAGG

Paste this into a BLAST search page for me
ACCGTCGGCGACTGCAACATCGAGGGCAACATCGAGGAGCCGGAAGATGAATGCCCACCTTTGAGGAGATCGTCGAGAAGGCCCGCTACAACGCCTGGAACCACCTTTGAGGAGATCGTCGAGAACTGGAAGAGCAAGGCCGGTCTGACCGGTCTGACCGCCGATGATGCCAAGGATGCCAAGGCCTACTACATCGAGGTCAAGGCCTACTACATCGAGGTCTACAGGTCTACAAGAAGTACGCTCCCCAAAGAAGTACGCTCCCCAGTACGAATACTTCAAGAACCTGCCTAGCAAGGAACCTGCCTAGCAAGGAGGAGTTCCTGAGTTCTACGGCTACTACAAGCAGG

Full Affymetrix probeset data:

Annotations for 1633251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720