FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633254_at:

>probe:Drosophila_2:1633254_at:90:385; Interrogation_Position=325; Antisense; GAACATCGGGTTCTCCAACACGGTG
>probe:Drosophila_2:1633254_at:404:171; Interrogation_Position=358; Antisense; AAAGTTTCTGGTTTGCGCGGACTGC
>probe:Drosophila_2:1633254_at:430:555; Interrogation_Position=389; Antisense; GGACCTGTGGGCTACCATGATCTGA
>probe:Drosophila_2:1633254_at:528:161; Interrogation_Position=453; Antisense; ACAAGGACACCTAGCTGCAGCGATG
>probe:Drosophila_2:1633254_at:408:617; Interrogation_Position=468; Antisense; TGCAGCGATGCCAAACACGTGTGTC
>probe:Drosophila_2:1633254_at:160:181; Interrogation_Position=480; Antisense; AAACACGTGTGTCCAGTCTCTTGCA
>probe:Drosophila_2:1633254_at:658:497; Interrogation_Position=495; Antisense; GTCTCTTGCAATCCATTTTATCATG
>probe:Drosophila_2:1633254_at:441:701; Interrogation_Position=510; Antisense; TTTTATCATGCCACTTATCCGCTAA
>probe:Drosophila_2:1633254_at:84:483; Interrogation_Position=543; Antisense; GTATCAGTTTTTCATGCCACGGAAT
>probe:Drosophila_2:1633254_at:100:431; Interrogation_Position=608; Antisense; GAGTATTTCCTTGAACATGCACTAT
>probe:Drosophila_2:1633254_at:111:689; Interrogation_Position=630; Antisense; TATTTGTACACTACCATCCTCTAGT
>probe:Drosophila_2:1633254_at:63:383; Interrogation_Position=691; Antisense; GAACGAATTCGCTGAAAATCCGTGA
>probe:Drosophila_2:1633254_at:502:369; Interrogation_Position=720; Antisense; GAAGGCCTAGTTTGTCGAGTTTAGA
>probe:Drosophila_2:1633254_at:696:303; Interrogation_Position=872; Antisense; CCTGGTCATTAAAAACATCGCTCTT

Paste this into a BLAST search page for me
GAACATCGGGTTCTCCAACACGGTGAAAGTTTCTGGTTTGCGCGGACTGCGGACCTGTGGGCTACCATGATCTGAACAAGGACACCTAGCTGCAGCGATGTGCAGCGATGCCAAACACGTGTGTCAAACACGTGTGTCCAGTCTCTTGCAGTCTCTTGCAATCCATTTTATCATGTTTTATCATGCCACTTATCCGCTAAGTATCAGTTTTTCATGCCACGGAATGAGTATTTCCTTGAACATGCACTATTATTTGTACACTACCATCCTCTAGTGAACGAATTCGCTGAAAATCCGTGAGAAGGCCTAGTTTGTCGAGTTTAGACCTGGTCATTAAAAACATCGCTCTT

Full Affymetrix probeset data:

Annotations for 1633254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720