FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633255_at:

>probe:Drosophila_2:1633255_at:719:559; Interrogation_Position=333; Antisense; GGAAAACCTTATGCCAACGTGTCGC
>probe:Drosophila_2:1633255_at:721:509; Interrogation_Position=379; Antisense; GTGCAACTCATTGGCAGTTTCAGTC
>probe:Drosophila_2:1633255_at:512:91; Interrogation_Position=394; Antisense; AGTTTCAGTCAATCCAACCTCATGA
>probe:Drosophila_2:1633255_at:688:365; Interrogation_Position=432; Antisense; GAATCATCCGGGTCCAGAGTGCGAA
>probe:Drosophila_2:1633255_at:134:181; Interrogation_Position=471; Antisense; AAAAATTTTCATCGCGCCAACTTCA
>probe:Drosophila_2:1633255_at:57:315; Interrogation_Position=502; Antisense; GCCAGGCCCGATAACTACGATACAG
>probe:Drosophila_2:1633255_at:510:717; Interrogation_Position=541; Antisense; TTGGCCAAATACAGGACACGTCCGT
>probe:Drosophila_2:1633255_at:569:171; Interrogation_Position=648; Antisense; AAAGAACGCATTAGCCGCATTCAAA
>probe:Drosophila_2:1633255_at:31:213; Interrogation_Position=683; Antisense; AAGATCGGGCCATTTTGGACAAAGC
>probe:Drosophila_2:1633255_at:334:559; Interrogation_Position=699; Antisense; GGACAAAGCATTGGCACACCGAATT
>probe:Drosophila_2:1633255_at:371:163; Interrogation_Position=740; Antisense; AAATTCCGCATGAGACAAATCCGTG
>probe:Drosophila_2:1633255_at:544:45; Interrogation_Position=758; Antisense; ATCCGTGCAGGGTCGATCTAATTCG
>probe:Drosophila_2:1633255_at:426:141; Interrogation_Position=795; Antisense; ACTGGGACGCGCAATGTTTGAAACT
>probe:Drosophila_2:1633255_at:468:357; Interrogation_Position=831; Antisense; GCACAACAGTTTGGTCGCTACGAAC

Paste this into a BLAST search page for me
GGAAAACCTTATGCCAACGTGTCGCGTGCAACTCATTGGCAGTTTCAGTCAGTTTCAGTCAATCCAACCTCATGAGAATCATCCGGGTCCAGAGTGCGAAAAAAATTTTCATCGCGCCAACTTCAGCCAGGCCCGATAACTACGATACAGTTGGCCAAATACAGGACACGTCCGTAAAGAACGCATTAGCCGCATTCAAAAAGATCGGGCCATTTTGGACAAAGCGGACAAAGCATTGGCACACCGAATTAAATTCCGCATGAGACAAATCCGTGATCCGTGCAGGGTCGATCTAATTCGACTGGGACGCGCAATGTTTGAAACTGCACAACAGTTTGGTCGCTACGAAC

Full Affymetrix probeset data:

Annotations for 1633255_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720